BMRB Entry 4175
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4175
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pappalardo, L.; Kerwood, D.; Pelczer, I.; Borer, P.. "Three-dimensional Folding of an RNA Hairpin Required for Packaging HIV-1" J. Mol. Biol. 282, 801-818 (1998).
Assembly members:
SL3 RNA hairpin, polymer, 20 residues, Formula weight is not available
Natural source: Common Name: Human Immunodeficiency virus, type 1 Taxonomy ID: 11676 Superkingdom: virus Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
SL3 RNA hairpin: GGACUAGCGGAGGCUAGUCC
- assigned_chemical_shifts
| Data type | Count |
| 31P chemical shifts | 19 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | SL3 RNA hairpin | 1 |
Entities:
Entity 1, SL3 RNA hairpin 20 residues - Formula weight is not available
| 1 | G | G | A | C | U | A | G | C | G | G | |
| 2 | A | G | G | C | U | A | G | U | C | C |
Samples:
sample_one: SL3 RNA hairpin 30 mM
sample_conditions_one: pH: 7; temperature: 303 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| NOESY | sample_one | not available | not available |
| DQF-COSY | sample_one | not available | not available |
| H-PCOSY | sample_one | not available | not available |
Software:
No software information available
NMR spectrometers:
- Bruker DRX 500 MHz