Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34880
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Dierks, D.; Weisz, K.. "Structural Differences at Quadruplex-Duplex Interfaces Enable Ligand-Induced Topological Transitions" Adv. Sci. (Weinh) ., e2309891-e2309891 (2024).
PubMed: 38477454
Assembly members:
entity_1, polymer, 31 residues, 9771.240 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCGCGAAGCATTCGCGGG
GTTAGGGTGGG
| Data type | Count |
| 13C chemical shifts | 45 |
| 1H chemical shifts | 207 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 31 residues - 9771.240 Da.
| 1 | DG | DG | DG | DC | DG | DC | DG | DA | DA | DG | ||||
| 2 | DC | DA | DT | DT | DC | DG | DC | DG | DG | DG | ||||
| 3 | DG | DT | DT | DA | DG | DG | DG | DT | DG | DG | ||||
| 4 | DG |
sample_1: DNA (31-MER) 1 mM
sample_2: DNA (31-MER), [U-10% 13C; U-10% 15N]-Gua, 0.2 mM
sample_3: DNA (31-MER), [U-10% 15N]-Gua, 0.2 mM
sample_conditions_1: ionic strength: 120 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment, peak picking
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
TopSpin v4.0.7, Bruker Biospin - processing