Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27289
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Zhang, Kaiming; Keane, Sarah; Zhaoming, Su; Irobalieva, Rossitza; Chen, Muyuan; Van, Verna; Sciandra, Carly; Marchant, Jan; Heng, Xiao; Schmid, Michael; Case, David; Ludtke, Steven; Summers, Michael; Chiu, Wah. "Structure of the 30 kDa HIV-1 RNA Dimerization Signal by a Hybrid Cryo-EM, NMR, and Molecular Dynamics Approach" Structure S0969-2126, 30001-30007 (2018).
PubMed: 29398526
Assembly members:
DIS, polymer, 47 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: recombinant technology Host organism: in vitro transcription Vector: n/a
Entity Sequences (FASTA):
DIS: GGCAGGACUCGGCUUGCUGA
AGCGCGCACGGCAAGAGGCG
AGGGGCC
Data type | Count |
1H chemical shifts | 214 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | DIS | 1 |
Entity 1, DIS 47 residues - Formula weight is not available
1 | G | G | C | A | G | G | A | C | U | C | ||||
2 | G | G | C | U | U | G | C | U | G | A | ||||
3 | A | G | C | G | C | G | C | A | C | G | ||||
4 | G | C | A | A | G | A | G | G | C | G | ||||
5 | A | G | G | G | G | C | C |
DIS_G8C6r: DIS, G8C6r, 300 uM; TRIS, [U-2H], 20 mM
DIS_H: DIS 300 uM; TRIS, [U-2H], 20 mM
DIS_A2rGr: DIS, A2rGr, 300 uM; TRIS, [U-2H], 20 mM
DIS_A28GH: DIS, A28GH, 300 uM; TRIS, [U-2H], 20 mM
sample_conditions_1: pH: 7.5; pressure: 1 atm; temperature: 308 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | DIS_H | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | DIS_A2rGr | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | DIS_A28GH | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | DIS_G8C6r | isotropic | sample_conditions_1 |
NMRView, Johnson, One Moon Scientific - chemical shift assignment, data analysis, processing
TOPSPIN, Bruker Biospin - collection
CYANA, Guntert, Mumenthaler and Wuthrich - geometry optimization
AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement