Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25526
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Elke, Duchardt-Ferner; Julia, Weigand; Oliver, Ohlenschlaeger; Sina, Schmidtke; Beatrix, Suess; Jens, Woehnert. "What a Difference an OH Makes: Conformational Dynamics as the Basis for the Ligand Specificity of the Neomycin-Sensing Riboswitch" Angew. Chem. Int. Ed. 55, 1527-1530 (2016).
PubMed: 26661511
Assembly members:
RNA_(27-MER), polymer, 27 residues, 8557.091 Da.
RIBOSTAMYCIN, non-polymer, 454.473 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: reverse transcriptase
Entity Sequences (FASTA):
RNA_(27-MER): GGCUGCUUGUCCUUUAAUGG
UCCAGUC
| Data type | Count |
| 13C chemical shifts | 180 |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 205 |
| 31P chemical shifts | 8 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | RIBOSTAMYCIN | 2 |
Entity 1, entity_1 27 residues - 8557.091 Da.
| 1 | G | G | C | U | G | C | U | U | G | U | ||||
| 2 | C | C | U | U | U | A | A | U | G | G | ||||
| 3 | U | C | C | A | G | U | C |
Entity 2, RIBOSTAMYCIN - C17 H34 N4 O10 - 454.473 Da.
| 1 | RIO |
sample_1: entity_1 0.8 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%
sample_2: entity_1, [U-100% 15N], 0.8 mM; RIBOSTAMYCIN 0.9 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%
sample_3: entity_1, [U-100% 13C; U-100% 15N], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; D2O 100%
sample_4: entity_1, [U-13C; U-15N; U-2H], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; D2O 100%
sample_5: entity_1, [U-100% 13C; U-100% 15N], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%
sample_6: entity_1, [U-13C; U-15N; U-2H], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%
sample_conditions_1: pH: 6.2; temperature: 282.5 K
sample_conditions_2: pH: 6.2; temperature: 283 K
sample_conditions_3: pH: 6.2; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_2 |
| 3D 1H-15N NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_3 |
| 3D HNCO | sample_5 | isotropic | sample_conditions_2 |
| 3D H(CCO)NH | sample_5 | isotropic | sample_conditions_2 |
| 3D 1H-13C NOESY | sample_3 | isotropic | sample_conditions_3 |
| 3D 1H-13C NOESY | sample_3 | isotropic | sample_conditions_3 |
| 2D 1H-1H TOCSY | sample_4 | isotropic | sample_conditions_3 |
| 2D DQF-COSY | sample_4 | isotropic | sample_conditions_3 |
| 2D 1H-1H NOESY | sample_4 | isotropic | sample_conditions_3 |
| 2D 1H-1H TOCSY | sample_6 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_6 | isotropic | sample_conditions_2 |
TOPSPIN v2.1, Bruker Biospin - collection, processing
CARA v1.8.4.2, Wuthrich - chemical shift assignment, peak picking
SPARKY, Goddard - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - structure solution