BMRB Entry 25526

Title:
Re-refined solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex
Deposition date:
2015-03-09
Original release date:
2016-02-01
Authors:
Duchardt-Ferner, Elke; Gottstein-Schmidtke, Sina; Weigand, Julia; Ohlenschlaeger, Oliver; Wurm, Jan-Philip; Hammann, Christian; Suess, Beatrix; Woehnert, Jens
Citation:

Citation: Elke, Duchardt-Ferner; Julia, Weigand; Oliver, Ohlenschlaeger; Sina, Schmidtke; Beatrix, Suess; Jens, Woehnert. "What a Difference an OH Makes: Conformational Dynamics as the Basis for the Ligand Specificity of the Neomycin-Sensing Riboswitch "  Angew. Chem. Int. Ed. 55, 1527-1530 (2016).
PubMed: 26661511

Assembly members:

Assembly members:
RNA_(27-MER), polymer, 27 residues, 8557.091 Da.
RIBOSTAMYCIN, non-polymer, 454.473 Da.

Natural source:

Natural source:   Common Name: not available   Taxonomy ID: not available   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:

Experimental source:   Production method: reverse transcriptase

Entity Sequences (FASTA):

Entity Sequences (FASTA):
RNA_(27-MER): GGCUGCUUGUCCUUUAAUGG UCCAGUC

Data sets:
Data typeCount
13C chemical shifts180
15N chemical shifts27
1H chemical shifts205
31P chemical shifts8

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11
2RIBOSTAMYCIN2

Entities:

Entity 1, entity_1 27 residues - 8557.091 Da.

1   GGCUGCUUGU
2   CCUUUAAUGG
3   UCCAGUC

Entity 2, RIBOSTAMYCIN - C17 H34 N4 O10 - 454.473 Da.

1   RIO

Samples:

sample_1: entity_1 0.8 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%

sample_2: entity_1, [U-100% 15N], 0.8 mM; RIBOSTAMYCIN 0.9 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%

sample_3: entity_1, [U-100% 13C; U-100% 15N], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; D2O 100%

sample_4: entity_1, [U-13C; U-15N; U-2H], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; D2O 100%

sample_5: entity_1, [U-100% 13C; U-100% 15N], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%

sample_6: entity_1, [U-13C; U-15N; U-2H], 1.1 mM; RIBOSTAMYCIN 1.2 mM; potassium phosphate 25 mM; potassium chloride 50 mM; H2O 90%; D2O 10%

sample_conditions_1: pH: 6.2; temperature: 282.5 K

sample_conditions_2: pH: 6.2; temperature: 283 K

sample_conditions_3: pH: 6.2; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_2
3D 1H-15N NOESYsample_2isotropicsample_conditions_2
2D 1H-13C HSQCsample_3isotropicsample_conditions_3
3D HNCOsample_5isotropicsample_conditions_2
3D H(CCO)NHsample_5isotropicsample_conditions_2
3D 1H-13C NOESYsample_3isotropicsample_conditions_3
3D 1H-13C NOESYsample_3isotropicsample_conditions_3
2D 1H-1H TOCSYsample_4isotropicsample_conditions_3
2D DQF-COSYsample_4isotropicsample_conditions_3
2D 1H-1H NOESYsample_4isotropicsample_conditions_3
2D 1H-1H TOCSYsample_6isotropicsample_conditions_2
2D 1H-1H NOESYsample_6isotropicsample_conditions_2

Software:

TOPSPIN v2.1, Bruker Biospin - collection, processing

CARA v1.8.4.2, Wuthrich - chemical shift assignment, peak picking

SPARKY, Goddard - chemical shift assignment, peak picking

CYANA, Guntert, Mumenthaler and Wuthrich - structure solution

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 700 MHz
  • Bruker Avance 800 MHz
  • Bruker Avance 900 MHz
  • Bruker Avance 950 MHz