Click here to enlarge.
PDB ID: 6hyk
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34321
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chagot, M.; Quinternet, M.; Rothe, B.; Charpentier, B.; Coutant, J.; Manival, X.; Lebars, I.. "The yeast C/D box snoRNA U14 adopts a "weak" K-turn like conformation recognized by the Snu13 core protein in solution." Biochimie 164, 70-82 (2019).
PubMed: 30914254
Assembly members:
entity_1, polymer, 31 residues, 9998.949 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
entity_1: GGCACGGUGAUGACCUUCGG
GUCUGAGUGCC
Data type | Count |
13C chemical shifts | 207 |
15N chemical shifts | 77 |
1H chemical shifts | 242 |
31P chemical shifts | 11 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 31 residues - 9998.949 Da.
1 | G | G | C | A | C | G | G | U | G | A | ||||
2 | U | G | A | C | C | U | U | C | G | G | ||||
3 | G | U | C | U | G | A | G | U | G | C | ||||
4 | C |