BMRB Entry 30622

Title:
Solution Structure of lncRNA (LINK-A) 20-nt Hexaloop Hairpin
Deposition date:
2019-06-28
Original release date:
2020-06-26
Authors:
Amado, A.; Walker, M.; Varani, G.
Citation:

Citation: Amado, A.; Walker, M.; Varani, G.. "Structure of the lncRNA LINK-A Hexaloop Hairpin in PI(3,4,5)P3 Interaction"  .

Assembly members:

Assembly members:
entity_1, polymer, 20 residues, 6414.854 Da.

Natural source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Experimental source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGAGGGUAGACUCGCUCUCC

Data sets:
Data typeCount
13C chemical shifts109
15N chemical shifts8
1H chemical shifts163

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 20 residues - 6414.854 Da.

1   GGAGGGUAGA
2   CUCGCUCUCC

Samples:

sample_1: RNA 0.9 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_2: RNA 0.6 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_3: RNA, [U-13C; U-15N], 0.5 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_4: RNA, [U-13C; U-15N], 0.5 mM; Sodium Phosphate 20 mM; EDTA 0.01 mM

sample_conditions_1: pH: 6.0; pressure: 1 atm; temperature: 278 K

sample_conditions_2: pH: 6.0; pressure: 1 atm; temperature: 298 K

sample_conditions_3: pH: 6.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_2isotropicsample_conditions_3
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_2

Software:

TopSpin, Bruker Biospin - processing

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

Sparky, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker AVANCE III 800 MHz
  • Bruker AVANCE III 600 MHz