Click here to enlarge.
PDB ID: 6pk9
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30622
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Amado, A.; Walker, M.; Varani, G.. "Structure of the lncRNA LINK-A Hexaloop Hairpin in PI(3,4,5)P3 Interaction" .
Assembly members:
entity_1, polymer, 20 residues, 6414.854 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAGGGUAGACUCGCUCUCC
Data type | Count |
13C chemical shifts | 109 |
15N chemical shifts | 8 |
1H chemical shifts | 163 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 20 residues - 6414.854 Da.
1 | G | G | A | G | G | G | U | A | G | A | |
2 | C | U | C | G | C | U | C | U | C | C |