Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34533
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Preckwinkel, P.; Mohr, S.; Weisz, K.. "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands" Chemistry 26, 16910-16922 (2020).
PubMed: 32975874
Assembly members:
entity_1, polymer, 36 residues, 11340.253 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GATCAGTTTTACTGATCGGG
TGGTGGGTGGGGAAGG
| Data type | Count |
| 1H chemical shifts | 242 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 36 residues - 11340.253 Da.
| 1 | DG | DA | DT | DC | DA | DG | DT | DT | DT | DT | ||||
| 2 | DA | DC | DT | DG | DA | DT | DC | DG | DG | DG | ||||
| 3 | DT | DG | DG | DT | DG | DG | DG | DT | DG | DG | ||||
| 4 | DG | DG | DA | DA | DG | DG |
sample_1: nucleic acid 0.62 mM
sample_2: nucleic acid 0.25 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C HSQC aromatic | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_2 | isotropic | sample_conditions_1 |
CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment, data analysis, peak picking
X-PLOR NIH v2.52, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
TopSpin v4.0.7, Bruker Biospin - processing
Amber v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement