BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 34533

Title: Structure of a parallel c-myc modified with 5' duplex stem-loop and 3' diagonal snap-back loop   PubMed: 32975874

Deposition date: 2020-07-20 Original release date: 2020-10-01

Authors: Vianney, Y.; Weisz, K.

Citation: Vianney, Y.; Preckwinkel, P.; Mohr, S.; Weisz, K.. "Quadruplex-Duplex Junction: A High-Affinity Binding Site for Indoloquinoline Ligands"  Chemistry ., .-. (2020).

Assembly members:
entity_1, polymer, 36 residues, 11340.253 Da.

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GATCAGTTTTACTGATCGGG TGGTGGGTGGGGAAGG

Data sets:
Data typeCount
1H chemical shifts242

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11

Entities:

Entity 1, unit_1 36 residues - 11340.253 Da.

1   DGDADTDCDADGDTDTDTDT
2   DADCDTDGDADTDCDGDGDG
3   DTDGDGDTDGDGDGDTDGDG
4   DGDGDADADGDG

Samples:

sample_1: nucleic acid' 'natural abundance

sample_2: nucleic acid' 'natural abundance

sample_conditions_1: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQC aromaticsample_2isotropicsample_conditions_1
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D DQF-COSYsample_2isotropicsample_conditions_1

Software:

CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment, data analysis, peak picking

X-PLOR NIH v2.52, Schwieters, Kuszewski, Tjandra and Clore - structure calculation

TopSpin v4.0.7, Bruker Biospin - processing

Amber v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement

NMR spectrometers:

  • Bruker AVANCE NEO 600 MHz