Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34565
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: De Rache, A.; Marquevielle, J.; Bouaziz, S.; Vialet, B.; Andreola, M.; Mergny, J.; Amrane, S.. "Structure of a DNA G-quadruplex that Modulates SP1 Binding Sites Architecture in HIV-1 Promoter
" J. Mol. Biol. 436, 168359-168359 (2024).
PubMed: 37952768
Assembly members:
entity_1, polymer, 22 residues, 6970.461 Da.
entity_K, non-polymer, 39.098 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: AGGGAGGTGTGGCCTGGGCG
GG
| Data type | Count |
| 13C chemical shifts | 108 |
| 1H chemical shifts | 208 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
| 3 | unit_3 | 2 |
Entity 1, unit_1 22 residues - 6970.461 Da.
| 1 | DA | DG | DG | DG | DA | DG | DG | DT | DG | DT | ||||
| 2 | DG | DG | DC | DC | DT | DG | DG | DG | DC | DG | ||||
| 3 | DG | DG |
Entity 2, unit_2 - K - 39.098 Da.
| 1 | K |
sample_1: HIVpro2 2.4 mM; KCl 70 mM; KPi 20 mM
sample_2: HIVpro2 857 uM; KCl 70 mM; KPi 20 mM
sample_conditions_1: ionic strength: 90 mM; pH: 6.9; pressure: 1 atm; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_1 | anisotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | anisotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - data analysis
Sparky, Goddard - chemical shift assignment
ARIA, Linge, O'Donoghue and Nilges - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement