BMRB Entry 30665

Title:
NMR assignment and RNA structure of 5' UTR region stem loop from West Nile Virus   PubMed: 32807496
Deposition date:
2019-09-01
Original release date:
2020-08-18
Authors:
Sharma, S.; Varani, G.
Citation:

Citation: Sharma, S.; Varani, G.. "NMR structure of Dengue West Nile viruses stem-loop B: A key cis-acting element for flavivirus replication"  Biochem. Biophys. Res. Commun. 531, 522-527 (2020).

Assembly members:

Assembly members:
entity_1, polymer, 37 residues, 11841.064 Da.

Natural source:

Natural source:   Common Name: West Nile virus   Taxonomy ID: 11082   Superkingdom: Viruses   Kingdom: not available   Genus/species: Flavivirus West Nile virus

Experimental source:   Production method: chemical synthesis

Experimental source:

Natural source:   Common Name: West Nile virus   Taxonomy ID: 11082   Superkingdom: Viruses   Kingdom: not available   Genus/species: Flavivirus West Nile virus

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGUUUCUUAGCACGAAGAUC UCGAUGUCUAAGAAACC

Data sets:
Data typeCount
13C chemical shifts215
15N chemical shifts13
1H chemical shifts277

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 37 residues - 11841.064 Da.

1   GGUUUCUUAG
2   CACGAAGAUC
3   UCGAUGUCUA
4   AGAAACC

Samples:

sample_1: entity_1, [U-99% 13C; U-99% 15N], 0.5 ± 0.1 mM; sodium phosphate 20 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D NOESYsample_1isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1
1H protonsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_1

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

Sparky, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker AVANCE II 600 MHz
  • Bruker AVANCE II 800 MHz