Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5371
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Huppler, Anna; Nikstad, Laura; Allmann, Anne; Brow, David; Butcher, Samuel. "Metal binding and base ionization in the U6 RNA intramolecular stem-loop
structure" Nat. Struct. Biol. 9, 431-435 (2002).
PubMed: 11992125
Assembly members:
U6 RNA, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
U6 RNA: GGUUCCCCUGCAUAAGGAUG
AACC
Data type | Count |
13C chemical shifts | 41 |
15N chemical shifts | 14 |
1H chemical shifts | 211 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | U6 RNA 1 | 1 |
Entity 1, U6 RNA 1 24 residues - Formula weight is not available
1 | G | G | U | U | C | C | C | C | U | G | ||||
2 | C | A | U | A | A | G | G | A | U | G | ||||
3 | A | A | C | C |
sample_1: U6 RNA, [U-100% 13C; U-15N], 1.0 mM
cond_1: ionic strength: 0.05 M; pH: 7.0; temperature: 303 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
not available | sample_1 | not available | cond_1 |
No software information available