BMRB Entry 4226

Name: The Lead-Dependent Ribozyme
Published: 1999-12-23

Click here to enlarge.

PDB ID: 1ldz
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4226
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

The Lead-Dependent Ribozyme

Deposition date:

1998-08-19

Original release date:

1999-12-23

Authors:

Hoogstraten, C.; Legault, P.; Pardi, A.

Citation:

Citation: Legault, P.; Hoogstraten, C.; Metlitzky, E.; Pardi, A.. "Order, Dynamics, and Metal-Binding in the Lead-Dependent Ribozyme" J. Mol. Biol. 284, 325-335 (1998).

Assembly members:

Assembly members:
lead-dependent ribozyme, polymer, 30 residues, Formula weight is not available

Natural source:

Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available

Experimental source:

Experimental source: Production method: cell free synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
lead-dependent ribozyme: GCGACCGAGCCAGCGAAAGU UGGGAGUCGC

Data sets:

assigned_chemical_shifts
- chem_shift_sets

Data type	Count
13C chemical shifts	206
15N chemical shifts	92
1H chemical shifts	278

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	lead-dependent ribozyme	1

Entities:

Entity 1, lead-dependent ribozyme 30 residues - Formula weight is not available

1	G	C	G	A	C	C	G	A	G	C
2	C	A	G	C	G	A	A	A	G	U
3	U	G	G	G	A	G	U	C	G	C

Samples:

sample_1: lead-dependent ribozyme, [U-99% 13C; U-99% 15N], 1.2 mM; sodium phosphate 10 mM; sodium chloride 100 mM; EDTA 0.2 mM

sample_cond_1: ionic strength: 0.1 M; pH*: 5.5; pressure: 1 atm; temperature: 298 K

Experiments:

Name	Sample	Sample state	Sample conditions
NOESY	sample_1	not available	sample_cond_1
CPMG-NOESY	sample_1	not available	sample_cond_1
BD-NOESY	sample_1	not available	sample_cond_1
CBD-NOESY	sample_1	not available	sample_cond_1
NOESY-HSQC	sample_1	not available	sample_cond_1
CBD-NOESY-HSQC	sample_1	not available	sample_cond_1
HMQC-NOESY-HSQC	sample_1	not available	sample_cond_1
HCCH-E.COSY	sample_1	not available	sample_cond_1
directed HCC-TOCSY-CCH-E.COSY	sample_1	not available	sample_cond_1
spin-echo difference CT-HCCH-COSY	sample_1	not available	sample_cond_1

Software:

FELIX v2.3.0, 95.0 - Data Processing

NMR spectrometers:

Varian UnityPlus 500 MHz
Varian UnityInova 600 MHz
Bruker DMX 750 MHz