Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34543
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Bielskute, S.; Plavec, J.; Podbevsek, P.. "Oxidative lesions modulate G-quadruplex stability and structure in the human BCL2 promoter" Nucleic Acids Res. 49, 2346-2356 (2021).
PubMed: 33638996
Assembly members:
entity_1, polymer, 25 residues, 7961.097 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGGGCGCGGGAGGAAGGGGG
CGGGA
| Data type | Count |
| 13C chemical shifts | 26 |
| 1H chemical shifts | 140 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 25 residues - 7961.097 Da.
| 1 | DC | DG | DG | DG | DC | DG | DC | DG | DG | DG | ||||
| 2 | DA | DG | DG | DA | DA | DG | DG | DG | DG | DG | ||||
| 3 | DC | DG | DG | DG | DA |
sample_1: bcl2ex 0.7 mM
sample_2: bcl2ex 0.7 mM
sample_conditions_1: ionic strength: 90 mM; pH: 7; pressure: 101325 Pa; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_2 | isotropic | sample_conditions_1 |
CcpNmr Analysis, CCPN - chemical shift assignment
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing