Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4120
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kolk, M.; Van der Graaf, M.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.. "NMR Structure of a Classical Pseudoknot: Interplay of Single- and
Double-Stranded RNA" Science 280, 434-438 (1998).
PubMed: 9545221
Assembly members:
TYMV pseudoknot, polymer, 44 residues, Formula weight is not available
Natural source: Common Name: TYMV Taxonomy ID: 12154 Superkingdom: not available Kingdom: not available Genus/species: Tymovirus Turnip yellow mosaic virus
Experimental source: Production method: enzymatic synthesis
Entity Sequences (FASTA):
TYMV pseudoknot: GGGAGCUCAACUCUCCCCCC
CUUUUCCGAGGGUCAUCGGA
ACCA
| Data type | Count |
| 13C chemical shifts | 297 |
| 1H chemical shifts | 339 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | TYMV pseudoknot | 1 |
Entity 1, TYMV pseudoknot 44 residues - Formula weight is not available
| 1 | G | G | G | A | G | C | U | C | A | A | ||||
| 2 | C | U | C | U | C | C | C | C | C | C | ||||
| 3 | C | U | U | U | U | C | C | G | A | G | ||||
| 4 | G | G | U | C | A | U | C | G | G | A | ||||
| 5 | A | C | C | A |
sample_1: TYMV pseudoknot1 2.5 mM; TYMV pseudoknot, [13C/15N adenine], 1 2.5 mM; TYMV pseudoknot, [13C/15N uridine], 1 2.5 mM; MgCl2 10 mM
sample_cond_1: ionic strength: 10 mM; pH: 6.7; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| (13C-edited/X-filtered)NOESY | not available | not available | not available |
| TOCSY | not available | not available | not available |
| (31P spin echo difference)CTHSQC | not available | not available | not available |
| PCH | not available | not available | not available |
| HCCH-TOCSY | not available | not available | not available |
| CT-TOCSY-HSQC | not available | not available | not available |
| HNCCCH | not available | not available | not available |
No software information available