Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30577
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Liu, Wenting; Lin, Clement; Wu, Guanhui; Dai, Jixun; Chang, Ta-Chau; Yang, Danzhou. "Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition" Nucleic Acids Res. 47, 11931-11942 (2019).
PubMed: 31740959
Assembly members:
entity_1, polymer, 22 residues, 7008.510 Da.
entity_BO6, non-polymer, 403.518 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGT
AA
| Data type | Count |
| 1H chemical shifts | 253 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2, 1 | 2 |
| 3 | entity_2, 2 | 2 |
Entity 1, entity_1 22 residues - 7008.510 Da.
| 1 | DT | DG | DA | DG | DG | DG | DT | DG | DG | DG | ||||
| 2 | DT | DA | DG | DG | DG | DT | DG | DG | DG | DT | ||||
| 3 | DA | DA |
Entity 2, entity_2, 1 - C28 H25 N3 - 403.518 Da.
| 1 | BO6 |
sample_1: DNA (5'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3') 2 mM; BMVC 3 mM; potassium phosphate 25 mM; potassium chloride 70 mM
sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
X-PLOR, Brunger - refinement
InsightII, Accelrys Software Inc. - refinement, structure calculation
SPARKY, Goddard - chemical shift assignment, peak picking