Click here to enlarge.
PDB ID: 8bwt
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34777
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Voegele, J.; Duchardt-Ferner, E.; Bains, J.; Knezic, B.; Wacker, A.; Sich, C.; Goerlach, M.; Weigand, J.; Sponer, J.; Krepl, M.; Schwalbe, H.; Woehnert, J.. "Structure of a symmetrical internal loop motif with three consecutive U:U mismatches from stem-loop 1 in the 3'-UTR of the SARS-CoV2 genomic RNA" .
Assembly members:
entity_1, polymer, 26 residues, 8242.842 Da.
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCGUUUUCGCUUCGGCGUU
UACGCC
Data type | Count |
13C chemical shifts | 88 |
15N chemical shifts | 23 |
1H chemical shifts | 128 |
31P chemical shifts | 10 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 26 residues - 8242.842 Da.
1 | G | G | C | G | U | U | U | U | C | G | ||||
2 | C | U | U | C | G | G | C | G | U | U | ||||
3 | U | A | C | G | C | C |