Click here to enlarge.
PDB ID: 2n6x
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25785
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Barnwal, Ravi; Loh, Edmund; Godin, Kate; Yip, Jordan; Lavender, Hayley; Tang, Christoph; Varani, Gabriele. "Structure and mechanism of a molecular rheostat, an RNA thermometer that modulates immune evasion by Neisseria meningitidis" Nucleic Acids Res. 44, 9426-9437 (2016).
PubMed: 27369378
Assembly members:
CssA5_RNA_(43-MER), polymer, 43 residues, 13741.223 Da.
Natural source: Common Name: b-proteobacteria Taxonomy ID: 487 Superkingdom: Bacteria Kingdom: not available Genus/species: Neisseria meningitidis
Experimental source: Production method: in vitro transcription
Entity Sequences (FASTA):
CssA5_RNA_(43-MER): GGUGAGUACGUAGAGUAUAC
UUCGGUAUACUUAUAUACUU
ACC
Data type | Count |
13C chemical shifts | 32 |
15N chemical shifts | 18 |
1H chemical shifts | 204 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (43-MER) | 1 |
Entity 1, RNA (43-MER) 43 residues - 13741.223 Da.
1 | G | G | U | G | A | G | U | A | C | G | ||||
2 | U | A | G | A | G | U | A | U | A | C | ||||
3 | U | U | C | G | G | U | A | U | A | C | ||||
4 | U | U | A | U | A | U | A | C | U | U | ||||
5 | A | C | C |