Click here to enlarge.
PDB ID: 7kbv
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30803
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dickerhoff, Jonathan; Dai, Jixun; Yang, Danzhou. "Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes" Nucleic Acids Res. 49, 5905-5915 (2021).
PubMed: 33978746
Assembly members:
entity_1, polymer, 22 residues, 7033.523 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGAGGGTGGGTAGGGTGGGG
AA
Data type | Count |
13C chemical shifts | 26 |
1H chemical shifts | 208 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 22 residues - 7033.523 Da.
1 | DT | DG | DA | DG | DG | DG | DT | DG | DG | DG | ||||
2 | DT | DA | DG | DG | DG | DT | DG | DG | DG | DG | ||||
3 | DA | DA |