BMRB Entry 15745

Title:
Solution structure of stem-loop alpha; of the hepatitis B virus post-transcriptional regulatory element   PubMed: 18263618
Deposition date:
2008-04-28
Original release date:
2008-09-25
Authors:
Ohlenschlager, Oliver; Gorlach, Matthias; Schwalbe, Martin
Citation:

Citation: Schwalbe, Martin; Ohlenschlager, Oliver; Marchanka, Aliaksandr; Ramachandran, Ramadurai; Hafner, Sabine; Heise, Tilman; Gorlach, Matthias. "Solution structure of stem-loop alpha of the hepatitis B virus post-transcriptional regulatory element"  Nucleic Acids Research 36, 1681-1689 (2008).

Assembly members:

Assembly members:
RNA, polymer, 22 residues, 7105.313 Da.

Natural source:

Natural source:   Common Name: hepatitis B virus   Taxonomy ID: 10407   Superkingdom: Virus   Kingdom: not available   Genus/species: Orthohepadnavirus Hepatitis B virus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli   Vector: pUC19

Experimental source:

Natural source:   Common Name: hepatitis B virus   Taxonomy ID: 10407   Superkingdom: Virus   Kingdom: not available   Genus/species: Orthohepadnavirus Hepatitis B virus

Experimental source:   Production method: recombinant technology   Host organism: Escherichia coli   Vector: pUC19

Entity Sequences (FASTA):

Entity Sequences (FASTA):
RNA: GGCUCGCAGCAGGUCUGGAG UC

Data sets:
Data typeCount
13C chemical shifts145
15N chemical shifts50
1H chemical shifts195

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3')1

Entities:

Entity 1, RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3') 22 residues - 7105.313 Da.

1   GGCUCGCAGC
2   AGGUCUGGAG
3   UC

Samples:

sample_1: RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3'), [U-100% 13C; U-100% 15N], 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 0.2 mM; D2O 10%; H2O 90%

sample_2: RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3'), [U-100% 13C; U-100% 15N], 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 0.2 mM; D2O 99%

sample_conditions_1: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K

sample_conditions_2: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 293 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_1isotropicsample_conditions_2
2D 1H-13C HSQCsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_2isotropicsample_conditions_2
3D HCCH-TOCSYsample_2isotropicsample_conditions_2

Software:

CYANA v2.0, Guntert, Mumenthaler and Wuthrich - structure solution

XEASY, Bartels et al. - chemical shift assignment, peak picking

VNMR, Varian - collection, processing

OPAL, Luginbuhl, Guntert, Billeter and Wuthrich - collection, refinement

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 750 MHz

Related Database Links:

GB D00329