Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15745
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Schwalbe, Martin; Ohlenschlager, Oliver; Marchanka, Aliaksandr; Ramachandran, Ramadurai; Hafner, Sabine; Heise, Tilman; Gorlach, Matthias. "Solution structure of stem-loop alpha of the hepatitis B virus
post-transcriptional regulatory element" Nucleic Acids Research 36, 1681-1689 (2008).
PubMed: 18263618
Assembly members:
RNA, polymer, 22 residues, 7105.313 Da.
Natural source: Common Name: hepatitis B virus Taxonomy ID: 10407 Superkingdom: Virus Kingdom: not available Genus/species: Orthohepadnavirus Hepatitis B virus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pUC19
Entity Sequences (FASTA):
RNA: GGCUCGCAGCAGGUCUGGAG
UC
Data type | Count |
13C chemical shifts | 145 |
15N chemical shifts | 50 |
1H chemical shifts | 195 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3') | 1 |
Entity 1, RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3') 22 residues - 7105.313 Da.
1 | G | G | C | U | C | G | C | A | G | C | ||||
2 | A | G | G | U | C | U | G | G | A | G | ||||
3 | U | C |
sample_1: RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3'), [U-100% 13C; U-100% 15N], 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 0.2 mM; D2O 10%; H2O 90%
sample_2: RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3'), [U-100% 13C; U-100% 15N], 1 mM; potassium phosphate 10 mM; potassium chloride 40 mM; EDTA 0.2 mM; D2O 99%
sample_conditions_1: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 283 K
sample_conditions_2: ionic strength: 50 mM; pH: 6.2; pressure: 1 atm; temperature: 293 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_2 |
2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_2 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY | sample_2 | isotropic | sample_conditions_2 |
3D HCCH-TOCSY | sample_2 | isotropic | sample_conditions_2 |
CYANA v2.0, Guntert, Mumenthaler and Wuthrich - structure solution
XEASY, Bartels et al. - chemical shift assignment, peak picking
VNMR, Varian - collection, processing
OPAL, Luginbuhl, Guntert, Billeter and Wuthrich - collection, refinement