BMRB Entry 15745
Click here to enlarge.
PDB ID: 2jym
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15745
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Schwalbe, Martin; Ohlenschlager, Oliver; Marchanka, Aliaksandr; Ramachandran, Ramadurai; Hafner, Sabine; Heise, Tilman; Gorlach, Matthias. "Solution structure of stem-loop alpha of the hepatitis B virus
post-transcriptional regulatory element" Nucleic Acids Research 36, 1681-1689 (2008).
PubMed: 18263618
Assembly members:
RNA, polymer, 22 residues, 7105.313 Da.
Natural source: Common Name: hepatitis B virus Taxonomy ID: 10407 Superkingdom: Virus Kingdom: not available Genus/species: Orthohepadnavirus Hepatitis B virus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pUC19
Entity Sequences (FASTA):
RNA: GGCUCGCAGCAGGUCUGGAG
UC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 145 |
| 15N chemical shifts | 50 |
| 1H chemical shifts | 195 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3') | 1 |
Entities:
Entity 1, RNA (5'-R(*GP*GP*CP*UP*CP*GP*CP*AP*GP*CP*AP*GP*GP*UP*CP*UP*GP*GP*AP*GP*UP*C)-3') 22 residues - 7105.313 Da.
| 1 | G | G | C | U | C | G | C | A | G | C | ||||
| 2 | A | G | G | U | C | U | G | G | A | G | ||||
| 3 | U | C |