Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30701
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: LeBlanc, Regan; Kasprzak, Wojciech; Longhini, Andrew; Olenginski, Lukasz; Abulwerdi, Fardokht; Ginocchio, Stefano; Shields, Brigit; Nyman, Julie; Svirydava, Maryia; Del Vecchio, Claudia; Ivanic, Joseph; Schneekloth, John; Shapiro, Bruce; Dayie, Theodore Kwaku; Le Grice, Stuart. "Structural insights of the conserved "priming loop" of hepatitis B virus pre-genomic RNA
" J. Biomol. Struct. Dyn. 40, 9761-9773 (2022).
PubMed: 34155954
Assembly members:
entity_1, polymer, 61 residues, 19541.488 Da.
Natural source: Common Name: HBV Taxonomy ID: 10407 Superkingdom: Viruses Kingdom: not available Genus/species: Orthohepadnavirus HBV
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUUCAUGUCCUACUGUUCA
AGCCUCCAAGCUGUGCCUUG
GGUGGCUUUGGGGCAUGGAC
C
| Data type | Count |
| 13C chemical shifts | 164 |
| 15N chemical shifts | 27 |
| 1H chemical shifts | 283 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 61 residues - 19541.488 Da.
| 1 | G | G | U | U | C | A | U | G | U | C | ||||
| 2 | C | U | A | C | U | G | U | U | C | A | ||||
| 3 | A | G | C | C | U | C | C | A | A | G | ||||
| 4 | C | U | G | U | G | C | C | U | U | G | ||||
| 5 | G | G | U | G | G | C | U | U | U | G | ||||
| 6 | G | G | G | C | A | U | G | G | A | C | ||||
| 7 | C |
sample_1: RNA (61-MER), [U-13C; U-15N], 0.8 mM
sample_2: RNA (61-MER), [U-13C; U-15N], 0.8 mM
sample_3: RNA (61-MER), 13C-selective, 0.7 mM
sample_conditions_1: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY | sample_2 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aliphatic | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCN | sample_1 | isotropic | sample_conditions_1 |
| 2D HNCCNCH | sample_2 | isotropic | sample_conditions_1 |
| Filter/Edit NOESY | sample_3 | isotropic | sample_conditions_1 |
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking