Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51310
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Chiu, Liang-Yuan; Emery, Ann; Jain, Niyati; Sugarman, Andrew; Kendrick, Nashea; Luo, Le; Ford, William; Swanstrom, Ronald; Tolbert, Blanton. "Encoded Conformational Dynamics of the HIV Splice Site A3 Regulatory Locus: Implications for Differential Binding of hnRNP Splicing Auxiliary Factors
" J. Mol. Biol. 434, 167728-167728 (2022).
PubMed: 35870649
Assembly members:
entity_1, polymer, 43 residues, Formula weight is not available
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: In vitro transcription Host organism: n/a
Entity Sequences (FASTA):
entity_1: GGUGCUGUUUAUCCAUUUCA
GAAUUGGGUGUCGACAUAGC
ACC
| Data type | Count |
| 1H chemical shifts | 137 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 43 residues - Formula weight is not available
| 1 | G | G | U | G | C | U | G | U | U | U | ||||
| 2 | A | U | C | C | A | U | U | U | C | A | ||||
| 3 | G | A | A | U | U | G | G | G | U | G | ||||
| 4 | U | C | G | A | C | A | U | A | G | C | ||||
| 5 | A | C | C |
sample_1: ESS2p Equimolar mix, selective deuteration, 450 uM
sample_2: ESS2p fully protonated 400 uM
sample_3: ESS2p_N15_HSQC, [U-100% 15N] on GTP and UTP, 300 uM
sample_4: ESS2p_uniform_N15, [U-100% 13C; U-100% 15N], 300 uM
sample_5: ESS2p_uniform_N15_C13, [U-100% 13C; U-100% 15N] on ATP and GTP, 200 uM
sample_conditions_1: ionic strength: 5 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 5 mM; pH: 6.5; pressure: 1 atm; temperature: 283 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-13C HMQC | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_2 |
| 2D 1H-15N HNN-COSY | sample_4 | isotropic | sample_conditions_2 |
AMBER - refinement
NMRDraw - Data processing
NMRPipe - Data processing
TOPSPIN - Data collection
NMRViewJ - chemical shift assignment
X-PLOR NIH - structure calculation