Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30972
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pham, V.; Gao, M.; Meagher, J.; Smith, J.; D'Souza, V.. "A structure-based mechanism for displacement of the HEXIM adapter from 7SK small nuclear RNA
" Commun. Biol. 5, 819-819 (2022).
PubMed: 35970937
Assembly members:
entity_1, polymer, 56 residues, 17986.635 Da.
entity_2, polymer, 17 residues, 2172.551 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAUCUGUCACCCCAUUGA
UCGCCAGUGGCUGAUCUGGC
UGGCUAGGCGGGUCCC
entity_2: GISYGRKKRRHRRRAHQ
| Data type | Count |
| 1H chemical shifts | 222 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entity 1, unit_1 56 residues - 17986.635 Da.
| 1 | G | G | G | A | U | C | U | G | U | C | ||||
| 2 | A | C | C | C | C | A | U | U | G | A | ||||
| 3 | U | C | G | C | C | A | G | U | G | G | ||||
| 4 | C | U | G | A | U | C | U | G | G | C | ||||
| 5 | U | G | G | C | U | A | G | G | C | G | ||||
| 6 | G | G | U | C | C | C |
Entity 2, unit_2 17 residues - 2172.551 Da.
| 1 | GLY | ILE | SER | TYR | GLY | ARG | LYS | LYS | ARG | ARG | ||||
| 2 | HIS | ARG | ARG | ARG | ALA | HIS | GLN |
sample_1: Tat G 0.5 ± 0.2 mM; 7SK 0.5 ± 0.2 mM; Phosphate 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_2: Tat G 0.5 ± 0.2 mM; 7SK 0.5 ± 0.2 mM; Phosphate 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_conditions_1: ionic strength: 80 mM; pH: 5.6; pressure: 100000 Pa; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - collection
NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - data analysis, processing, structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation