Click here to enlarge.
PDB ID: 8fcs
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31061
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ma, Sicong; Kotar, Anita; Hall, Ian; Grote, Scott; Rouskin, Silvi; Keane, Sarah. "Structure of pre-miR-31 reveals an active role in Dicer-TRBP complex processing" Proc. Natl. Acad. Sci. U. S. A. 120, e2300527120-e2300527120 (2023).
PubMed: 37725636
Assembly members:
entity_1, polymer, 71 residues, 22872.592 Da.
Natural source: Common Name: human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAGAGGAGGCAAGAUGCUG
GCAUAGCUGUUGAACUGGGA
ACCUGCUAUGCCAACAUAUU
GCCAUCUUUCC
Data type | Count |
13C chemical shifts | 54 |
1H chemical shifts | 329 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 71 residues - 22872.592 Da.
1 | G | G | A | G | A | G | G | A | G | G | ||||
2 | C | A | A | G | A | U | G | C | U | G | ||||
3 | G | C | A | U | A | G | C | U | G | U | ||||
4 | U | G | A | A | C | U | G | G | G | A | ||||
5 | A | C | C | U | G | C | U | A | U | G | ||||
6 | C | C | A | A | C | A | U | A | U | U | ||||
7 | G | C | C | A | U | C | U | U | U | C | ||||
8 | C |