Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_anomalous, AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR7354
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kopke Salinas, Roberto; Folkers, Gert; Bonvin, Alexandre; Das, Devashish; Boelens, Rolf; Kaptein, Robert. "Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor" Chembiochem 6, 1628-1637 (2005).
PubMed: 16094693
Assembly members:
LAC-GAL_OPERATOR, polymer, 22 residues, Formula weight is not available
LAC_HEADPIECE_1-62, polymer, 62 residues, Formula weight is not available
Natural source: Common Name: ESCHERICHIA COLI Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: recombinant technology Host organism: ESCHERICHIA COLI Vector: PET3A / PGP1-2
Entity Sequences (FASTA):
LAC-GAL_OPERATOR: GAATTGTAAGCGCTTACAAT
TC
LAC_HEADPIECE_1-62: MKPVTLYDVAEYAGVSVATV
SRVVNQASHVSAKTREKVEA
AMAELNYIPNRCAQQLAGKQ
SL
| Data type | Count |
| 13C chemical shifts | 248 |
| 15N chemical shifts | 70 |
| 1H chemical shifts | 544 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | LAC_REPRESSOR | 1 |
| 2 | LAC_REPRESSOR | 1 |
| 3 | LAC_REPRESSOR | 2 |
| 4 | LAC_REPRESSOR | 2 |
Entity 1, LAC_REPRESSOR 22 residues - Formula weight is not available
| 1 | DG | DA | DA | DT | DT | DG | DT | DA | DA | DG | ||||
| 2 | DC | DG | DC | DT | DT | DA | DC | DA | DA | DT | ||||
| 3 | DT | DC |
Entity 2, LAC_REPRESSOR 62 residues - Formula weight is not available
| 1 | MET | LYS | PRO | VAL | THR | LEU | TYR | ASP | VAL | ALA | ||||
| 2 | GLU | TYR | ALA | GLY | VAL | SER | VAL | ALA | THR | VAL | ||||
| 3 | SER | ARG | VAL | VAL | ASN | GLN | ALA | SER | HIS | VAL | ||||
| 4 | SER | ALA | LYS | THR | ARG | GLU | LYS | VAL | GLU | ALA | ||||
| 5 | ALA | MET | ALA | GLU | LEU | ASN | TYR | ILE | PRO | ASN | ||||
| 6 | ARG | CYS | ALA | GLN | GLN | LEU | ALA | GLY | LYS | GLN | ||||
| 7 | SER | LEU |
sample: LAC_REPRESSOR mM; D2O 5%; H2O 95%
sample_conditions_1: ionic strength: 20 mM; pH: 6.0; pressure: 1.0 atm; temperature: 315.0 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D 15N NOESY-HSQC | sample | isotropic | sample_conditions_1 |
| 3D 13C NOESY-HSQC | sample | isotropic | sample_conditions_1 |
| 2D NOESY | sample | isotropic | sample_conditions_1 |
| 2D NOESY WITH X-FILTERS | sample | isotropic | sample_conditions_1 |
| 3D CBCACONH | sample | isotropic | sample_conditions_1 |
| 3D HNCO | sample | isotropic | sample_conditions_1 |
| 3D HBHACONH | sample | isotropic | sample_conditions_1 |
| 3D HCCCONH | sample | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample | isotropic | sample_conditions_1 |
| 2D 1H-15N J- MODULATED HSQC | sample | isotropic | sample_conditions_1 |
CNS, BRUNGER,ADAMS,CLORE,DELANO,GROS, GROSSE-KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,READ,RICE,SIMONSON,WARREN - refinement
CNS - structure solution
| PDB |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks