Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6062
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Cabello-Villegas, Javier; Giles, Keith; Soto, Ana; Yu, Ping; Mougin, A.; Beemon, Karen; Wang, Yun-Xing. "Solution structure of the pseudo-5' splice site of a retroviral splicing
suppressor
" RNA 10, 1388-1398 (2004).
PubMed: 15317975
Assembly members:
RNA stem-loop, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: Rous sarcoma virus Taxonomy ID: 11886 Superkingdom: Viruses Kingdom: not available Genus/species: alpharetrovirus Rous sarcoma virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA stem-loop: GGGGAGUGGUUUGUAUCCUU
CCC
| Data type | Count |
| 13C chemical shifts | 153 |
| 15N chemical shifts | 15 |
| 31P chemical shifts | 17 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | NRS23 | 1 |
Entity 1, NRS23 23 residues - Formula weight is not available
| 1 | G | G | G | G | A | G | U | G | G | U | ||||
| 2 | U | U | G | U | A | U | C | C | U | U | ||||
| 3 | C | C | C |
Sample_1: RNA stem-loop, [U-13C; U-15N], 1.2 mM; sodium phosphate buffer 10 mM; NaCl 25 mM
condition_1: pH: 6.5; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-13C NOESY-HSQC | not available | not available | not available |
| 2D NOESY | not available | not available | not available |
| 15N/1H HMQC | not available | not available | not available |
| HCCH-TOCSY | not available | not available | not available |
| HCCH-COSY | not available | not available | not available |
| HNCCCH | not available | not available | not available |
| HCP | not available | not available | not available |
NMRDraw - Spectra analysis
NMRView - Spectra analysis
NMRPipe - Spectra processing