Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.


Number of entries returned: 506

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameProteinDNARNAOther
410314mer DNA duplex containing the operator sequence BS2X
4104BS2 operator DNA complexed with the Antennapedia HomeodomainXX
4141vnd/NK-2 homeodomain DNA complexXX
4165Tn916 integrase DNA complexXX
4172Rev-erb beta response elementX
4176DNA dodecamerX
4187Sigma-K RNA Polymerase Promoter Consensus SequenceX
4235DNA decamerX
4240Duplex DNA (5'-D(GP*GP*TP*CP*AP*CP*GP*AP*G)-3') (DOT)(5'-D(CP*TP*CP*GP*GP*GP*AP*CP*C)-3')X
4244alphaT decamer duplexX
42478mer chimeric hybrid RNA/RNA-DNA duplex with tRNA-DNA junctionXX
4248Lymphoid enhancer-binding factorXX
4359Pbx1 homeodomainXX
4361chromomycin-DNA complexXX
4362chromomycin-DNA complexXX
4368A35T vnd/NK2 mutant homeodomainXX
4392DNA minor groove binderX
4400H-y5 Triple HelixX
4409DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')X
4412DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')X
4415DNA dodecamer duplexX
4416Cis-syn thymine cyclobutane dimerX
4488DNA decamerX
4555SRY-14mer duplexX
4556SRY-8mer duplexX
4576a3T3 hybridX
4609T-tetrad telomere repeatsX
4647HPRT Gene Mutation Hotspot with a BPDE2(10R) AdductX
4687cyclic oligonucleotide dX
4694cyclic oligonucleotide dX
4708WT1 zinc finger domain DNA complexXX
4710WT1 zinc finger domainXX
4733bulge DNA 12/14merX
4734High mobility group protein of Drosophila complexed to a bulge DNAXX
5032AFX in complex with DNAXX
51645'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplexX
5167AT-Rich DNA with the GAA-Hairpin LoopX
5232Cdc13 DNA-binding domain /telomeric ssDNA complexXX
5349Extended PBX Homeodomain-DNA complexXX
5363hERR2-DNA complexXX
5370beta alanine linked polyamide bound to purine tract DNAX
53858oxoG:G mismatchX
5714Synthetic DNA duplex with an AG mismatchX
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplexX
5781Propynyl DNA.RNA hybridXX
5791Lactose operon repressorXX
5993DNA duplexX
6009Thrombin-binding DNA aptamerX
6276Metal-response element-binding transcription factor-1 complex with MRE DNAXX
6319nkx2.5 homeodomain plus NK2 specific domain in DNA bound stateXX
6353RFC p140 375-480 BRCT region : DNA complexXX
6430HIV-1 integrase inhibitor, 93delX
6445Metal-response element-binding transcription factor-1 complex with MRE DNA (22bp)XX
6605NMR ensemble Ada ProteinXX
6877HPV-16 E2C-DNA complexXX
6906Bicoid Homeodomain Bound to DNAXX
6975Bcl2MidG4Pu23-G15T G16TX
7097brinker CG9653-PA/DNA ComplexXX
7105SRY.B in complex with 16-mer DNAXX
7319polyermase beta in complex with substrate DNAXX
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXX
110475'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structuresXX
15026Nar1IQ3 DuplexX
15027Nar1 DuplexX
15033cyclic octamerX
15213IntCB-DNA complexXX
15223AB G alphaX
15224AB G betaX
15227duplex DNA containing an abasic site with opposite T (alpha anomer)X
15228duplex DNA containing an abasic site with opposite T (beta anomer)X
15238Ab C alphaX
15239Ab C betaX
15360DNA 12merX
15376modified DNA duplexX
15527Mbp1 14X
15898DNA GAAA tetraloopX
162811:1 complexX
162872:1 complexX
162881:2 complexX
162901:1 complexX
162912:1 complexX
162922:1 complexX
16449XPF DNA complexXX
16577Homeodomain DNA complexXX
16812MED1:DNA complexXX
16936MBD2 bound to a methylated DNAXX
17094DNA 1/berenil complexX
1712925-mer DNA oligomerX
17216PPBS/NCp7(12-55) exchangeXX
17217SARS/dT10 complexXX
17222operator/repressor complexXX
17225CSD/ssDNA complexXX
17339AREA/GATA complexXX
17397RET oncogeneX
17409triazole-linked DNA duplexX
17422Cidofovir DNA duplexX
17423Control DNA duplexX
17535DNA/RNA hybridXX
17562N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenalX
17580Myc G-quadruplexX
17592Anabaena Sensory Rhodopsin Transducer with DNAXX
17655Human Telomeric DNAX
17729C-Terminal domain of LerXX
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNAXX
17746(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNAX
17788gamma-hydroxy-1,N2-propano-2'-deoxyguanosine adductXX
17790(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adductX
17791(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adductX
17814DNA Containing an Aristolactam II-dA LesionX
17859DNA duplex Containing an Unnatural, Hydrophobic Base PairX
17885DNA dodecamerX
17887alpha anomeric lesionX
18040DNA 1X
18050DNA 1X
18199DNA 1X
18209DNA molecule G3ATG3ACACAG4ACG3X
18279human CEB25 minisatellite G-quadruplexX
184272'F-ANA and ANA self-complementary duplexX
18430Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -DeoxyadenosineX
18452Synthetic cyclic oligonucleotideXX
1845311 mer oligonucleotide-BX
1845411 mer oligonucleotide-BX
18496YdbC:dT19G1 complexXX
18625Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'X
18626Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with NetropsinX
1863811 mer oligonucleotide-BX
18639Duplex DNA Containing a b-Carba-Fapy-dG LesionX
18640Duplex DNA Containing a b-Carba-Fapy-dG LesionX
18724G-quadruplex DNAX
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyreneX
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-linkX
18835dodecamer duplexX
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutionsX
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybridXX
18902major G-quadruplexX
18907Duplex DNAX
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNAXX
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesionX
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomerX
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesionX
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomerX
18985DNA 1X
19017Bulges in G-quadruplexesX
19035G-rich VEGF aptamer with LNA modificationsX
19138ED ComplexXX
19222Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 601X
19276d[CGCGAAGCATTCGCG] hairpinX
19277d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybridX
19278d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybridX
19279d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybridX
19281d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybridX
19367complex formed by the region 2 of E. coli sigmaE and its cognate -10 non template element TGTCAAAXX
19375N2-dG IQ at G3 in NarI sequenceX
19386parallel-stranded G-quadruplex in DNA poly-G stretchesX
19387intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivativeX
19389stacked dimeric G-quadruplexX
19402antiparallel (2+2) G-quadruplexX
19435Complex between DNA quadruplex (human telomere) and DD-bisRuthenium ligandX
19440N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNAX
19441spermine modified DNA duplexX
19448dinuclear ruthenium(II) complexes that bind diastereoselectively to an anti-parallel folded human telomere sequenceX
19511homeodomain transcription factor Gbx1XX
19540MyT1 F4F5 - DNA complexXX
19592Molecular Binding of TFF1 Estrogen Response ElementX
19594G-quadruplex bound to the bisquinolinium compound Phen-DC3X
19620DNA duplex containing N3T-ethylene-N1IX
19653RRM domain from C. elegans SUP-12 + GGTGTGC DNAXX
19659RHB Modified duplexX
19661SHB modified duplexX
19695N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAX
19696N2-guanine adducts derived from the tumorigen dibenzo[a,l]pyrene in DNAX
19728A tetrahelical DNA fold adopted by alternating GGG and GCG tractsX
19734fd bacteriophageXX
19745DNA (28-MER)X
19747M13 bacteriophageXX
19784G-triplex truncated-TBAX
19805The dsDNA in intact bacteriophage T7X
19853AGA modifiedX
19861AGT FAPY Modified duplexX
19862AGC FAPY modified duplex Major isomerX
19863AG(7-deaza)G FAPY modified duplexX
19889CGACTAGTCG with AIK-18/51-1X
19890CGACTAGTCG dimerX
19912DNA duplexX
19917DNA dodecamer containing the 5-hydroxycytosineX
19925DNA dodecamer with A:C mismatchX
19939MBD4 methyl-cytosine binding domain bound to methylated DNAXX
25092MazE-DNA bindingXX
25099Hs2 dimerX
25110left-handed G-quadruplexX
25369DNA Dodecamer with 8-oxoguanine at 10th PositionX
25378A G-quadruplex structureX
25407DNA complex of the C-Terminal domain of MvaTXX
25528DNA Dodecamer with 8-oxoguanine at 4th PositionX
25531N2-dG IQ at G1 in NarI sequenceX
25582Protein and DNA complexXX
25651active G-quadruplex motif from AGRO100X
25672N-(2'deoxyguanosin-8-yl)-3-aminobenzanthrone DNA adductX
25686G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genomeX
25701EcoRV dimer with cognate DNAXX
25723Universal Base oligonucleotide with UB at point 5X
25724Control DNA oligonucleotide for the universal baseX
25746DNA G-quadruplexX
25752EcoRV dimer with cognate DNA and Lu3+XX
25759Quercetin complexed with c-myc G-quadruplex DNAX
25840Tetrameric i-motif structure of dT-dC-dC-CFL-CFL-dCX
25882dsDNA-lomaiviticin A complexX
25888F1F2-DNA complexXX
25890DNA freeX
25891PARP-1 F1F2F3-DNA complexXX
25894PARP-1 F1F2F3-WGR-DNA complexXX
25903Glucose in a DNA double helixX
25906Glucose as a nuclease mimic in DNAX
25915Photoswitchable G-quadruplexX
26731Paired domain of Pax5 in complex with DNAXX
26808Egr-1 DNA complexXX
27053KRAS oncogene promoter regionX
27144c-Myc Pu22X
27173KRAS promoter regionX
27364Kaiso-MeCG2 complexXX
27366KaisoE535Q-MeCG2 complexXX
27367KaisoE535A-MeCG2 complexXX
27368Kaiso-MeKBS complexXX
27369KaisoE535Q-MeKBS complexXX
27370KaisoE535A-MeKBS complexXX
27371Kaiso-MeKBSsemi complexXX
27372Kaiso-MeKBShemi complexXX
27409DNA polymerase betaXX
27410DNA polymerase beta ternary complexXX
27560protein-gapped DNA complexXX
27561protein-gapped DNA-nucelotide complexXX
27652NZ118 tetramerX
27828d(CGATATCG)2 : free formX
27829d(CGATATCG)2 : C-1305 complexX
27958spin labled DNA duplexX
28059CSD and ssDNA complexXX
28081Trimolecular G-quadruplexX
30015DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*GP*TP*GP*GP*GP*AP*(8OG)P*CP*G)-3')X
30016DNA (5'-D(*CP*GP*CP*TP*CP*(RIB)P*CP*AP*CP*GP*C)-3'), DNA (5'-D(*GP*CP*(8OG)P*TP*GP*GP*GP*AP*GP*CP*G)-3')X
30044DNA Dodecamer with 8-oxoguanine at 10th PositionX
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')X
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')X
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')X
30058DNA (25-MER)X
30105DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')XX
30111DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')X
30112DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')X
30113DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')XX
30114DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')XX
30115DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')XX
30116DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')XX
30117DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')XX
30148DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')X
30151DNA (5'-D(*CP*GP*(5CM)P*GP*AP*AP*TP*TP*CP*GP*CP*G)-3')X
30191DNA Dodecamer with 5-methylcytosineX
30198DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')X
30250DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')X
30251DNA (5'-D(*CP*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)P*(8OG)P*CP*G)-3')X
30252DNA (5'-D(*CP*GP*CP*(8OG)P*AP*AP*TP*TP*(DMC)P*GP*CP*G)-3')X
30255DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')X
30328DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')X
30329DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*(8OG)P*CP*G)-3')X
30335DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')X
30336DNA (5'-D(*CP*CP*AP*AP*GP*AP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*TP*CP*TP*TP*GP*G)-3')X
30402DNA (26-MER)X
30473Sp1 transcription factor duplex 5'-d(GGGGCGGGG)X
30484Sp1 transcription factor duplex 5'-d(GGGGCGGGA)X
30485Sp1 transcription factor duplex 5'-d(TGGGCGGGG)X
30506Sp1 transcription factor duplex 5'-d(TGGGCGGGA)X
30552DNA (27-MER)X
30805Myc2345 T23X
34053DNA (5'-D(*GP*TP*GP*TP*GP*GP*GP*TP*GP*TP*G)-3')X
34062G-quadruplex formed by a human telomeric sequence modified with 2'-fluoro-2'-deoxyriboguanosineX
34063Artificial quadruplex with propeller, diagonal and lateral loopX
34083UpsB-Q-1, DNA (34-MER)X
34084UpsB-Q-1 DNA (34-MER)X
34086DNA (26-MER)X
34118DNA (5'-D(*TP*(DCP)P*CP*GP*TP*TP*TP*CP*(PSC)P*GP*T)-3')X
34145G-quadruplex of Human papillomavirus type 52X
34157DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')X
34158DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')X
34159DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')X
34172ECF RNA polymerase sigma-E factor,ECF RNA polymerase sigma factor SigW,ECF RNA polymerase sigma-E factor/DNA ComplexXX
34174artificial quadruplex with propeller, diagonal, and lateral loopX
34221DNA (27-MER)X
34244DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') majorX
34245DNA (5'-D(*CP*GP*TP*CP*TP*CP*AP*TP*GP*AP*TP*AP*CP*G)-3') minorX
34276Tc-DNA/RNA duplexXX
34277tc-DNA/tc-DNA duplexX
34280Tc-DNA/DNA duplexX
34290functional pRN1 primase/DNA ComplexXX
34291functional pRN1 primase/DNA ComplexXX
34296DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')X
34302DNA (28-MER)X
34328DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')X
34353TINA-conjugated antiparallel DNA triplexX
34378Kiteplatinated DNA oligomerX
34389DNA (25-MER)X
34390DNA (25-MER)X
34397DNA (5'-(*(DC5)P*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*(DG3))-3')X
34431KRAS32R G9TX
34441KRAS32R G25TX
34467human telomeric G-quadruplexesX
34524DNA (36-MER)X
34525DNA (35-MER)X
34533DNA (36-MER)X
34579DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')X
34580DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3')X
34581DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')X
34588deoxyxylose nucleic acid hairpinX
34594DNA (5'-D(*CP*GP*TP*AP*(FFC)P*G)-3')X
34595DNA (5'-D(*CP*TP*AP*(FFC)P*AP*CP*GP*G)-3'), RNA (5'-R(*CP*CP*GP*UP*GP*UP*AP*G)-3')XX
34599DNA (5'-D(*CP*TP*AP*(FFC)P*AP*CP*GP*G)-3'), RNA (5'-R(*CP*CP*GP*UP*GP*UP*AP*G)-3')XX
34615DNA (31-MER)X
36001Switch-activating protein 1/DNA ComplexXX
36020DNA (5'-D(*CP*CP*TP*GP*CP*CP*TP*G)-3')X
36022DNA (5'-D(*TP*TP*TP*AP*TP*TP*TP*A)-3')X
36159G-quadruplex DNA (26-MER)X
36160G-quadruplex DNA (26-MER)X
36186Rok/DNA ComplexXX
50109d(GTATGGCCATAC)2 DNA duplexX
50604Nucleosome Core Particle (human)XX
50831Alkbh5 66-292XX