BMRB Entry 52355
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52355
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wieruszewska, Julia; Pawlowicz, Aleksandra; Polomska, Ewa; Pasternak, Karol; Gdaniec, Zofia; Andralojc, Witold. "The 8-17 DNAzyme can operate in a single active structure regardless of metal ion cofactor" Nat. Commun. 15, 4218-4218 (2024).
PubMed: 38760331
Assembly members:
entity_1, polymer, 35 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGCCGGGGTCGAAGACTGCC
AGCGGCTCGACGGCG
| Data type | Count |
| 1H chemical shifts | 2071 |
| 31P chemical shifts | 180 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 8-17 DNAzyme | 1 |
Entities:
Entity 1, 8-17 DNAzyme 35 residues - Formula weight is not available
| 1 | DC | DG | DC | DC | DG | DG | DG | DG | DT | DC | ||||
| 2 | DG | DA | DA | DG | DA | DC | DT | DG | DC | DC | ||||
| 3 | DA | DG | DC | DG | DG | DC | DT | DC | DG | DA | ||||
| 4 | DC | DG | DG | DC | DG |