Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25890
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Eustermann, Sebastian; Wu, Wing-Fung; Langelier, Marie-France; Yang, Ji-Chun; Easton, Laura; Riccio, Amanda; Pascal, John; Neuhaus, David. "Structural basis of detection and signaling of DNA single-strand breaks by human PARP 1
" Mol. Cell 60, 742-754 (2015).
PubMed: 26626479
Assembly members:
DNA_(45-MER), polymer, 45 residues, 13871.971 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(45-MER): GCTGGCTTCGTAAGAAGCCA
GCTCGCGGTCAGCTTGCTGA
CCGCG
| Data type | Count |
| 1H chemical shifts | 340 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | DNA (45-MER) | 1 |
Entity 1, DNA (45-MER) 45 residues - 13871.971 Da.
| 1 | DG | DC | DT | DG | DG | DC | DT | DT | DC | DG | ||||
| 2 | DT | DA | DA | DG | DA | DA | DG | DC | DC | DA | ||||
| 3 | DG | DC | DT | DC | DG | DC | DG | DG | DT | DC | ||||
| 4 | DA | DG | DC | DT | DT | DG | DC | DT | DG | DA | ||||
| 5 | DC | DC | DG | DC | DG |
free_DNA_D2O: DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
free_DNA_H2O: DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K
sample_conditions_2: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K
sample_conditions_3: ionic strength: 0.25 M; pH: 7.2; pressure: 1 atm; temperature: 273 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H TOCSY | free_DNA_D2O | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | free_DNA_D2O | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | free_DNA_H2O | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | free_DNA_H2O | isotropic | sample_conditions_2 |
X-PLOR_NIH v2.28, Schwieters, Kuszewski, Tjandra and Clore - structure solution
SPARKY v3.115, Goddard - chemical shift assignment
TOPSPIN v2.1, Bruker Biospin - processing
Analysis v2.4.1, CCPN - chemical shift assignment, data analysis
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis