Biological Magnetic Resonance Data Bank

A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.


Number of entries returned: 160

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NameCarbon shiftsNitrogen shiftsPhosphorus shiftsHydrogen shiftsOther shiftsProteinDNARNAOther
4135RNA duplex including the C-U mismatch01161630X
4141vnd/NK-2 homeodomain DNA complex291100189040XX
4172Rev-erb beta response element00282680X
4175SL3 RNA hairpin00191750X
4235DNA decamer009820X
4243DNA (5'-D(TCCCGTTTCCA)-3')0010840X
4244alphaT decamer duplex009940X
4361chromomycin-DNA complex80071520XX
4362chromomycin-DNA complex96071600XX
4415DNA dodecamer duplex00221930X
4416Cis-syn thymine cyclobutane dimer00221930X
4555SRY-14mer duplex00262430X
4556SRY-8mer duplex00141370X
5134dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'00272480X
5135dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'00262410X
5256Anticodon Stem-loop of tRNA(Phe)11016171470X
5259Anticodon Stem-loop of tRNA(Phe)10213141310X
5528RNA (25-MER):the complementary RNA promoter of influenza a virus00132190X
5553C4 promoter of influneza A virus2911182020X
5703U6 snRNA intramolecular stem loop66012040X
5705UUCG tetraloop13247141400X
6009Thrombin-binding DNA aptamer00141620X
61453LII in DMSO002620X
6146nisin/3LII complex733422640X
6273GTTCACAGAAC DNA hairpin00101010X
6430HIV-1 integrase inhibitor, 93del00151480X
6509ScYLV RNA pseudoknot21796282630X
6562D-loop from cloverleaf 1 of bovine enterovirus 1 RNA19793162620X
709018 mer hairpin hexaloop9021171490X
15033cyclic octamer2004430X
15360DNA 12mer00222660X
15376modified DNA duplex00151700X
15527Mbp1 141160252270X
15571RNA DUPLEX1240171820X
15869single polyribonucleotide27047292720X
15898DNA GAAA tetraloop4207720X
16609rna-ligand complex1805392480X
16714AUCG tetraloop hairpin10445131200X
1712925-mer DNA oligomer1390252540X
17309coronavirus stem-loop 235041230X
17351rG4 substituted Drew Dickerson dodecamer00111270X
17517Anticodon Stem-loop of Bacillus subtilis tRNATYR35016800X
17520Unmodified ASL Tyr11641161360X
17535DNA/RNA hybrid360161301XX
17887alpha anomeric lesion560181770X
17941IV-B RNA1794722430X
18040DNA 100202020X
18050DNA 10091790X
18239RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP*AP*UP*CP*UP*UP*C)-3')00151050X
18240Mutant of the sub-genomic promoter from Brome Mosaic Virus00141000X
18279human CEB25 minisatellite G-quadruplex560252330X
18656Internal Loop 5'GAGU/3'UGAG135101640X
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion00201790X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201790X
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion00211850X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer00201820X
18985DNA 100201820X
19158DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')00183490X
19159d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex00224280X
19222Four dodecamers that together cover 39 bp of the 5' half of the strong nucleosome positioning sequence 6010026400X
19290NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA8641821113270XX
19387intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative00232100X
19440N-[4,9,13-triazatridecan-1-yl]-2-deoxycytidine modified duplex DNA00141600X
19441spermine modified DNA duplex00141640X
19734fd bacteriophage390500XX
19784G-triplex truncated-TBA66091190X
25220RNA duplex2809830X
25291RNA duplex4808770X
254143' splice site influenza A: 11-nt hairpin0010970X
254153' splice site influenza A: 19-nt duplex00141400X
25526RNA 27-MER, RIBOSTAMYCIN1802782050X
2553426mer Box C/D RNA (5'-R(P*CP*UP*GP*AP*GP*CP*UP*CP*GP*AP*AP*AP*GP*AP*GP*CP*AP*AP*UP*GP*AP*UP*G)-3')17349900X
25603murine tumour necrosis factor alpha CDE RNA14833211850X
25604double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA1510221800X
25661rna-ligand complex25911272980X
25669self complementary Xylonucleic Acid duplex7207740X
25723Universal Base oligonucleotide with UB at point 500161360X
25724Control DNA oligonucleotide for the universal base00161330X
26568The structure of the SOLE element of oskar mRNA21338302510X
26842TMR-3 48nt-5-TAMRA38215734150X
27769Branchpoint duplex with pseudoU U2 snRNA site360191820X
27770Branchpoint duplex with U2 snRNA site350191860X
30044DNA Dodecamer with 8-oxoguanine at 10th Position00141860X
30052DNA (5'-D(*CP*GP*(RSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(RSG)P*CP*CP*G)-3')00181440X
30053DNA (5'-D(*CP*GP*GP*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*GP*CP*CP*G)-3')00161560X
30054DNA (5'-D(*CP*GP*(SSG)P*CP*CP*GP*CP*CP*GP*A)-3'), DNA (5'-D(*TP*CP*GP*GP*CP*GP*(SSG)P*CP*CP*G)-3')00181120X
30105DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')00161280XX
30111DNA (5'-D(*AP*TP*CP*CP*GP*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161290X
30112DNA (5'-D(*TP*TP*AP*GP*GP*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161290X
30113DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161280XX
30114DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161280XX
30115DNA/RNA (5'-D(*AP*TP*GP*GP*A)-R(P*G)-D(P*CP*TP*C)-3'), DNA (5'-D(*GP*AP*GP*CP*TP*CP*CP*AP*T)-3')00161280XX
30116DNA/RNA (5'-D(*AP*TP*CP*C)-R(P*G)-D(P*GP*TP*AP*G)-3'), DNA (5'-D(*CP*TP*AP*CP*CP*GP*GP*AP*T)-3')00161280XX
30117DNA/RNA (5'-D(*TP*TP*AP*G)-R(P*G)-D(P*CP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*GP*CP*CP*TP*AP*A)-3')00161280XX
30224phage GA operator RNA hairpin15849211960X
30253DNA (5'-D(*GP*CP*AP*TP*CP*GP*AP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*TP*CP*GP*AP*TP*GP*C)-3')11310221550X
30254DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*AP*AP*AP*AP*AP*AP*TP*CP*G)-3')11510221610X
30255DNA (5'-D(*CP*GP*AP*TP*TP*TP*TP*TP*TP*GP*GP*C)-3'), DNA (5'-D(*GP*CP*CP*(M1A)P*AP*AP*AP*AP*AP*TP*CP*G)-3')11510201600X
30268RNA (5'-R(*CP*CP*AP*GP*AP*AP*AP*CP*GP*GP*AP*UP*GP*GP*A)-3')00131520X
30473Sp1 transcription factor duplex 5'-d(GGGGCGGGG)700101640X
30546RNA (5'-R(*CP*GP*CP*AP*GP*CP*UP*UP*AP*CP*GP*C)-3'), RNA (5'-R(*GP*CP*GP*UP*GP*CP*UP*UP*UP*GP*CP*G)-3')24071480X
30547RNA (5'-R(*CP*GP*GP*GP*CP*AP*UP*CP*CP*G)-3')1805880X
34157DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1070223530X
34158DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1050223040X
34159DNA (5'-D(*CP*GP*AP*TP*GP*TP*AP*CP*AP*TP*CP*G)-3')1120223500X
34265RNA (5'-R(*UP*GP*GP*UP*GP*GP*U)-3')44071690X
34321RNA (31-MER)20777112420X
34323RNA duplex containing pseudouridine residue900161550X
34324RNA duplex containing pseudouridine residue830161550X
34328DNA (5'-*(DC5)P*GP*AP*TP*(P)P*TP*AP*(Z)P*AP*TP*CP*(DG3))-3')72011980X
34580DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*(SGT)P*G)-3')110162580X
34581DNA (5'-D(*CP*AP*CP*GP*CP*CP*GP*CP*TP*G)-3'), DNA (5'-D(*CP*AP*GP*CP*GP*GP*CP*GP*TP*G)-3')60172120X
50242[r(UGGUGG)d(U)]4 G-quadruplex006520X
50244[r(UGGUGG)(2'OMeU)]4 G-quadruplex007500X
50245[r(UGGUGGC]4 G-quadruplex007510X
50246[r(UGGUGGT)]4 G-quadruplex007500X
50247[r(UGGUGG)d(T)]4 G-quadruplex007510X
50248[r(UGGUGG)(LNA-T)]4 G-quadruplex007490X
50249[r(UGGUGGPs)]4 G-quadruplex007490X
507605 SL420469242280X