BMRB Entry 15869

Name: NMR Assignments of HIV-2 TAR RNA
Published: 2008-10-15

Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15869

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

NMR Assignments of HIV-2 TAR RNA

Deposition date:

2008-07-09

Original release date:

2008-10-15

Authors:

Carlomagno, Teresa; Amata, Irene; Williamson, James

Citation:

Citation: Carlomagno, Teresa; Amata, Irene; Williamson, James; Hennig, Mirko. "NMR Assignments of HIV-2 TAR RNA" Biomol. NMR Assignments 2, 167-169 (2008).
PubMed: 19636896

Assembly members:

Assembly members:
HIV-2_TAR, polymer, 30 residues, Formula weight is not available

Natural source:

Natural source: Common Name: HIV Taxonomy ID: 11709 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus Human immunodeficiency virus 2

Experimental source:

Experimental source: Production method: enzymatic semisynthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
HIV-2_TAR: GGCCAGAUUGAGCCUGGGAG CUCUCUGGCC

Data sets:

assigned_chemical_shifts
- assigned_chem_shift_list_1

Data type	Count
13C chemical shifts	270
15N chemical shifts	47
1H chemical shifts	272
31P chemical shifts	29

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	subunit 1	1

Entities:

Entity 1, subunit 1 30 residues - Formula weight is not available

nucleotides 16-46 are numbered consecutively; bulged residue 24 is omitted to allow for comparison with HIV-1 TAR

1	G	G	C	C	A	G	A	U	U	G
2	A	G	C	C	U	G	G	G	A	G
3	C	U	C	U	C	U	G	G	C	C

Samples:

sample_1: HIV-2 TAR, [U-99% 13C; U-99% 15N], 1 mM; Na-phosphate 10 mM; NaCl 50 mM; EDTA 0.1 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_2: HIV-2 TAR, [U-99% 13C; U-99% 15N], 1 mM; Na-phosphate 10 mM; NaCl 50 mM; EDTA 0.1 mM; D2O, [U-100% 2H], 100%

sample_3: HIV-2 TAR 2 mM; Na-phosphate 10 mM; NaCl 50 mM; EDTA 0.1 mM; H2O 90%; D2O, [U-100% 2H], 10%

sample_conditions_1: ionic strength: 0.05 M; pH: 6.4; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 0.05 M; pH: 6.4; pressure: 1 atm; temperature: 278 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-15N HSQC	sample_1	isotropic	sample_conditions_1
2D 1H-13C HSQC	sample_2	isotropic	sample_conditions_2
3D HCCH-COSY	sample_2	isotropic	sample_conditions_2
2D 1H-1H TOCSY	sample_3	isotropic	sample_conditions_2
2D DQF-COSY	sample_3	isotropic	sample_conditions_2

Software:

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis

FELIX, Accelrys Software Inc. - chemical shift assignment

SPARKY, Goddard - chemical shift assignment

NMR spectrometers:

Varian INOVA 600 MHz
Bruker DRX 800 MHz