Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51869
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ruckriegel, Stefanie; Hohmann, Katharina; Furtig, Boris. "A Protonated Cytidine Stabilizes the Ligand-Binding Pocket in the PreQ1 Riboswitch in Thermophilic Bacteria" Chembiochem 24, e202300228-e202300228 (2023).
PubMed: 37314020
Assembly members:
entity_1, polymer, 33 residues, Formula weight is not available
entity_PRF, non-polymer, 179.179 Da.
Natural source: Common Name: Caldanaerobacter subterraneus subsp. tengcongensis Taxonomy ID: 911092 Superkingdom: Bacteria Kingdom: not available Genus/species: Caldanaerobacter subterraneus
Experimental source: Production method: in vitro transcription Host organism: Escherichia coli
Entity Sequences (FASTA):
entity_1: CUGGGUCGCAGUAACCCCAG
UUAACAAAACAAG
| Data type | Count |
| 13C chemical shifts | 296 |
| 15N chemical shifts | 121 |
| 1H chemical shifts | 293 |
| 31P chemical shifts | 31 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | riboswitch | 1 |
| 2 | ligand | 2 |
Entity 1, riboswitch 33 residues - Formula weight is not available
| 1 | C | U | G | G | G | U | C | G | C | A | ||||
| 2 | G | U | A | A | C | C | C | C | A | G | ||||
| 3 | U | U | A | A | C | A | A | A | A | C | ||||
| 4 | A | A | G |
Entity 2, ligand - C7 H9 N5 O - 179.179 Da.
| 1 | PRF |
sample_1: preQ1 riboswitch, [U-99% 13C; U-99% 15N], 805 uM; PRF 1127 uM; D2O, [U-99% 2H], 10%
sample_conditions_1: ionic strength: 518 mM; pH: 6.2; pressure: 1 atm; temperature: 313 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC/HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HNN COSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HCP TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D CC-TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D HDQC | sample_1 | isotropic | sample_conditions_1 |
SPARKY - chemical shift assignment