BMRB - Biological Magnetic Resonance Bank

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

Data type(s): Polymer type(s): Polymer join type:

Number of entries returned: 164

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB ID	Entry Title	Carbon shifts	Nitrogen shifts	Phosphorus shifts	Hydrogen shifts	Other shifts	Protein	DNA	RNA	Other
4135	Assignments of a RNA Duplex Including the C-U Mismatch: Unusual Chemical Shifts of a Cytidine Amino Group in the C-U Pair.	0	1	16	163	0			X
4141	vnd/NK-2 Homeodomain DNA Complex Protein 1H, 13C, and 15N Chemical Shifts and HNHA Coupling Constant	291	100	18	904	0	X	X
4172	Response Element of the Orphan Nuclear Receptor Rev-erb Beta	0	0	28	268	0		X
4175	SL3 Hairpin from the Packaging Signal of HIV-1	0	0	19	175	0			X
4235	NMR Solution Structure of [d(GCGAATTCGC)2]	0	0	9	82	0		X
4243	Intercalated d(TCCCGTTTCCA) dimer	0	0	10	84	0		X
4244	NMR Solution Structure of [d(GCGAAT-3'-3'-alphaT-5'-5'-CGC)2]	0	0	9	94	0		X
4361	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	80	0	7	152	0		X		X
4362	Structure determination by restrained molecular dynamics using NMR pseudocontact shifts as experimentally determined constraints	96	0	7	160	0		X		X
4415	Solution-state structure of a DNA dodecamer duplex containing a cis-syn thymine cyclobutane dimer.	0	0	22	193	0		X
4416	Solution-State Structure of a DNA Dodecamer Duplex Containing a Cis-Syn Thymine Cyclobutane Dimer.	0	0	22	193	0		X
4547	Solution structure of a DNA.RNA hybrid containing an alpha-anomeric thymidine and polarity reversals: d(ATGG-3'-3'-(alpha-T)-5'-5'-GCTC).r(gagcaccau)	0	0	16	168	0		X	X
4555	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	0	0	26	243	0		X
4556	31P NMR analysis of the DNA conformation induced by protein binding:SRY-DNA complexes	0	0	14	137	0		X
4646	Structural NMR characterization of an 11-mer DNA Duplex Containing a 2'-deoxyaristeromycin 8-oxo-Guanine pair, nonhydrolyzable substrate analog for the DNA repair enzyme MutY	0	0	17	144	0		X
4692	SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT	0	0	21	245	0		X
4746	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and cobalt	80	0	7	127	0		X		X
4753	Average solution structure of d(TTGGCCAA)2 bound to Chromomycin-A3 and zinc	96	0	7	135	0		X		X
4816	Structural Features of an Influenza Virus Promoter and their Implications for Viral RNA Synthesis	39	23	22	224	0			X
4894	RNA recognition by a staufen double-stranded RNA-binding domain	345	93	4	781	0	X		X
5134	Solution Structure of dAAUAA DNA Bulge	0	0	27	248	0		X
5135	Solution Structure of dAATAA DNA Bulge	0	0	26	241	0		X
5245	Heteroduplex of chirally pure R-methylphosphonate/DNA duplex	0	0	13	109	0		X
5256	Solution Structure of the Unmodified Anticodon Stem-loop from E. coli tRNA(Phe)	110	16	17	147	0			X
5259	Solution Structure of the modified Anticodon Stem-loop from E. coli tRNA(Phe)	102	13	14	131	0			X
5282	Refinement of d(GCGAAGC) Hairpin Structure Using One- and Two-Bonds Residual Dipolar Couplings	35	9	6	68	0		X
5528	Solution structure of the complementary RNA promoter of influenza a virus	0	0	13	219	0			X
5553	Solution structure of influenza A virus C4 promoter	29	11	18	202	0			X
5586	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	0	0	8	77	0			X
5587	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	0	0	8	77	0			X
5588	Molecular Recognition in Purine-Rich Internal Loops: Thermodynamic, Structural, and Dynamic Consequences of Purine for Adenine Substitutions in 5'(rGGCAAGCCU)2	0	0	8	80	0			X
5614	Sheared A(anti)-A(anti) Pairs in a Destabilizing 2x2 Internal Loop: The NMR Structure of 5'(rGGCAAGCCU)2	0	0	8	77	0			X
5671	Overall structure and sugar dynamics of a DNA dodecamer from homo and heteronuclear dipolar couplings and 31P chemical shift anisotropy	0	0	22	0	0		X
5681	DIMERIC SOLUTION STRUCTURE OF THE CYCLIC OCTAMER CD(CGCTCATT)	0	0	8	91	0		X
5703	SP phosphorothioate U6 RNA ISL	66	0	1	204	0			X
5705	1H, 13C and 15N resonance assignment of an RNA UUCG Tetraloop	132	47	14	140	0			X
6009	NMR structure of the thrombin-binding DNA aptamer stabilized by Sr2+	0	0	14	162	0		X
6062	Assignments for the Negative Regulator of Splicing from Rous Sarcoma Virus residues 907 to 929	153	15	17	198	0			X
6145	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	0	0	2	62	0	X
6146	The pyrophosphate cage: the structure of the nisin/lipid II complex provides a blueprint for novel antibiotics	73	34	2	264	0	X
6273	1H and 31P chemical shift assignments for the triloop DNA hairpin 5'- GTTCACAGAAC - 3'	0	0	10	101	0		X
6430	1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del	0	0	15	148	0		X
6509	Solution Structure of the ScYLV P1-P2 Frameshifting Pseudoknot	217	96	28	263	0			X
6562	A novel cGUUAg tetraloop structure with a conserved yYNMGg-type backbone conformation from cloverleaf 1 of bovine enterovirus 1 RNA	197	93	16	262	0			X
6979	An Alternating Sheared AA Pair and Elements of Stability for a Single Sheared Purine-Purine Pair Flanked by Sheared GA Pairs	0	0	18	168	0			X
7090	Solution structure of a purine rich hexaloop hairpin belonging to PGY/MDR1 mRNA and targeted by antisense oligonucleotides	90	21	17	149	0			X
15033	Dimeric solution structure of the cyclic octamer d(CCGTCCGT)	20	0	4	43	0		X
15360	Solution Structures of a DNA Dodecamer Duplex	0	0	22	266	0		X
15376	SOLUTION STRUCTURE OF A DNA DUPLEX CONTAINING THE UNIVERSAL BASE 5-NITROINDOLE-3-CARBOXAMIDE	0	0	15	170	0		X
15527	1H, 13C, and 31P Chemical Shift Assignments for 14-mer Base Pair Non-self Complementary DNA Duplex ( Mbp1_14) which Contains the Consensus Binding Site of the Yeast Transcription Factor Mbp-1	116	0	25	227	0		X
15571	NMR STRUCTURE OF RNA DUPLEX	124	0	17	182	0			X
15572	NMR STRUCTURE OF RNA DUPLEX CONTAINING SINGLE ADENOSINE BULGE	112	0	19	173	0			X
15780	NMR structure of adenosine bulged RNA duplex with C:G-A triple	52	0	7	72	0			X
15781	NMR structure of uridine bulged RNA duplex	110	0	15	148	0			X
15869	NMR Assignments of HIV-2 TAR RNA	270	47	29	272	0			X
15898	H1, C13, 31P chemical shifts of dGCGAAAGC	42	0	7	72	0		X
16225	Solution Structure of cis-5R,6S-thymine glycol opposite complementary adenine in duplex DNA	0	0	20	231	0		X
16282	d(AGAGCTCT)2 assignments	0	0	7	48	0		X
16286	d(CGAGCTCG)2 assignments	0	0	7	46	0		X
16289	d(GCTATAGC)2 assignments	0	0	7	48	0		X
16609	1H, 13C, 15N chemical shift sssignments of the artificial neomycin-sensing riboswitch in complex with ribostamycin	180	53	9	248	0			X
16714	Structure of a human Xist RNA A-repeat AUCG tetraloop hairpin essential for X-inactivation	104	45	13	120	0			X
16950	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'AAGU/3'UGAA	29	4	10	104	0			X
16951	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'GAGC/3'CGAG	50	0	10	107	0			X
16952	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'UAGA/3'AGAU	29	5	10	95	0			X
16953	The Structure of RNA Internal Loops with Tandem AG Pairs: 5'UAGG/3'GGAU	19	0	8	81	0			X
17129	Chemical shifts of the 25-mer oligonucleotide encompassing the variable region of a MUC1 DNA aptamer.	139	0	25	254	0		X
17309	Solution structure of coronaviral stem-loop 2 (SL2)	35	0	4	123	0			X
17351	Ribonucleotide Perturbation of DNA Structure: Solution Structure of [d(CGC)r(G)d(AATTCGCG)]2	0	0	11	127	0				X
17406	Structure of a 4X4 Nucleotide RNA Internal Loop from an R2 Retrotransposon	24	8	20	156	0			X
17517	Pseudouridine_ASL_Tyr	35	0	16	80	0			X
17520	Unmodified_ASL_Tyr	116	41	16	136	0			X
17535	DNA / RNA Hybrid containing a central stereo specific Rp borano phosphate linkage	36	0	16	130	1		X	X
17887	DNA sequence context conceals alpha anomeric lesion	56	0	18	177	0		X
17941	the structure of subdomain IV-B from the CVB-3 IRES	179	47	2	243	0			X
18040	DNA TT mismatch and 2,7-BisNP	0	0	20	202	0		X
18050	Structure of a bis-naphthalene bound to a thymine-thymine DNA mismatch	0	0	9	179	0		X
18239	Pseudo-triloop from the sub-genomic promoter of Brome Mosaic Virus	0	0	15	105	0			X
18240	Mutant of the sub-genomic promoter from Brome Mosaic Virus	0	0	14	100	0			X
18279	human CEB25 minisatellite G-quadruplex	56	0	25	233	0		X
18656	Major Conformation of the Internal Loop 5'GAGU/3'UGAG	13	5	10	164	0			X
18973	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer	0	0	20	179	0		X
18979	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer	0	0	20	179	0		X
18981	DNA containing a cluster of 8-oxo-guanine and THF lesion	0	0	21	185	0		X
18984	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : alpha anomer (AP6, 8OG 14)	0	0	20	182	0		X
18985	DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer (6AP, 8OG14)	0	0	20	182	0		X
19158	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	0	0	18	349	0		X
19159	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	0	0	22	428	0		X
19222	NMR Studies of DNA Support the Role of Pre-Existing Minor Groove Variations in Nucleosome Indirect Readout	0	0	264	0	0		X
19290	NMR structure of human TDP-43 tandem RRMs in complex with UG-rich RNA	864	182	11	1327	0	X		X
19387	Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative	0	0	23	210	0		X
19440	NMR structure of DNA duplex	0	0	14	160	0		X
19441	NMR structure of spermine modified DNA duplex	0	0	14	164	0		X
19734	Complete chemical shift assignment of the ssDNA in the filamentous bacteriophage fd report on its conformation and on its interface with the capsid shell	39	0	5	0	0	X	X
19784	Solution structure of the G-triplex truncated-TBA	66	0	9	119	0		X
25220	N6-Methyladenosine RNA	28	0	9	83	0			X
25291	RNA duplex	48	0	8	77	0			X
25414	Structural features of a 3' splice site influenza A: 11-nt hairpin	0	0	10	97	0			X
25415	Structural features of a 3' splice site influenza A: 19-nt duplex	0	0	14	140	0			X
25526	Re-refined solution NMR Structure of the 27 nucleotide engineered neomycin sensing riboswitch RNA-ribostamycin complex	180	27	8	205	0			X
25534	RNA structure determination by solid-state NMR spectroscopy	173	49	9	0	0			X
25603	Structure of murine tumour necrosis factor alpha CDE RNA	148	33	21	185	0			X
25604	Solution structure of a double base-pair inversion mutant of murine tumour necrosis factor alpha CDE-23 RNA	151	0	22	180	0			X
25661	1H, 13C, and 15N chemical shift assignments of a the GTP class II RNA aptamer in complex with GTP	259	112	7	298	0			X
25669	Solution structure of a self complementary Xylonucleic Acid duplex	72	0	7	74	0			X
25723	Universal Base oligonucleotide structure	0	0	16	136	0		X
25724	Universal base control oligonucleotide structure	0	0	16	133	0		X
26568	The structure of the SOLE element of oskar mRNA	213	38	30	251	0			X
26842	NMR resonance assignments for the tetramethylrhodamine binding RNA aptamer 3 in complex with the ligand 5-carboxy-tetramethylrhodamine	382	157	3	415	0			X
27769	GA-branchsite-containing RNA duplex with unmodified U2 snRNA site	36	0	19	182	0			X
27770	GA-branchsite-containing RNA duplex with pseudouridine-modified U2 snRNA site	35	0	19	186	0			X
30038	Solution Structure of DNA Dodecamer with 8-oxoguanine at 4th Position	0	0	14	186	0		X
30044	Solution Structure of DNA Dodecamer with 8-oxoguanine at 10th Position	0	0	14	186	0		X
30052	NMR solution structure of [Rp, Rp]-PT dsDNA	0	0	18	144	0		X
30053	Solution NMR structure of PT-free dsDNA from Streptomyces lividans	0	0	16	156	0		X
30054	NMR solution structure of [Sp, Sp]-PT dsDNA	0	0	18	112	0		X
30105	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30111	Structural impact of single ribonucleotides in DNA	0	0	16	129	0		X
30112	Structural impact of single ribonucleotides in DNA	0	0	16	129	0		X
30113	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30114	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30115	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30116	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30117	Structural impact of single ribonucleotides in DNA	0	0	16	128	0		X		X
30224	Structure Effects of the Four-Adenine Loop of the Coliphage GA Replicase RNA Operator	158	49	21	196	0			X
30253	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A2-DNA structure	113	10	22	155	0		X
30254	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNA structure	115	10	22	161	0		X
30255	Insights into Watson-Crick/Hoogsteen Breathing Dynamics and Damage Repair from the Solution Structure and Dynamic Ensemble of DNA Duplexes containing m1A - A6-DNAm1A16 structure	115	10	20	160	0		X
30268	Structure of a GA Rich 8x8 Nucleotide RNA Internal Loop	0	0	13	152	0			X
30473	NMR structure for Sp1 transcription factor duplex 5'-d(GGGGCGGGG)	70	0	10	164	0		X
30546	RNA Duplex containing the internal loop 5'-GCUU/3'-UUCG	24	0	7	148	0			X
30547	RNA Duplex containing the internal loop 5'-GCAU/3'-UACG	18	0	5	88	0			X
30940	Hairpin near 3'-Splice Site of Influenza A Segment 7 Bound to 5-nt Oligonucleotide	0	0	12	177	0		X	X
34157	NtMe polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	107	0	22	353	0		X
34158	NtiPr polyamide in complex with 5'CGATGTACTACG3	105	0	22	304	0		X
34159	Im polyamide in complex with 5'CGATGTACATCG3'- hairpin polyamides studies	112	0	22	350	0		X
34265	Solution structure of the r(UGGUGGU)4 RNA quadruplex	44	0	7	169	0			X
34321	NMR solution structure of the C/D box snoRNA U14	207	77	11	242	0			X
34323	Structure of the RNA duplex containing pseudouridine residue (5'-Cp(PSU)pG-3' sequence context)	90	0	16	155	0			X
34324	Structure of the RNA duplex containing pseudouridine residue (5'-Gp(PSU)pC-3' sequence context)	83	0	16	155	0			X
34328	Dodecamer DNA containing the synthetic base pair P-Z	72	0	11	98	0		X
34436	Guanine-rich oligonucleotide with 5'-GC end form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pairs	0	0	11	115	0		X
34438	Guanine-rich oligonucleotide with 5'- and 3'-GC ends form G-quadruplex with A(GGGG)A hexad, GCGC- and G-quartets and two symmetric GG and AA base pair	0	0	13	132	0		X
34580	Single modified phosphoryl guanidine DNA duplex, Sp diastereomer	11	0	16	258	0		X
34581	DNA duplex with phosphoryl guanidine moiety, Rp-diastereomer	6	0	17	212	0		X
34685	Solution structure of a lanthanide-binding DNA aptamer	0	0	79	779	0		X
36168	Solution structure of G-quadruplex formed in vegfr-2 proximal promoter sequence	11	0	24	236	0		X
50242	Chemical shifts for [r(UGGUGG)d(U)]4 G-quadruplex	0	0	6	52	0			X
50244	[r(UGGUGG)(2'OMeU)]4 G-quadruplex	0	0	7	50	0			X
50245	[r(UGGUGGC)]4 G-quadruplex	0	0	7	51	0			X
50246	[r(UGGUGGT)]4 G-quadruplex	0	0	7	50	0			X
50247	[r(UGGUGG)d(T)]4 G-quadruplex	0	0	7	51	0			X
50248	[r(UGGUGG)(LNA-T)]4 G-quadruplex	0	0	7	49	0			X
50249	[r(UGGUGGPs)]4 G-quadruplex	0	0	7	49	0			X
50610	T9 DNA	0	0	88	84	0		X
50611	U9 DNA	0	0	88	164	0		X
50613	U8 DNA	0	0	88	160	0		X
50614	dhU3 DNA	0	0	77	164	0		X
50615	DDD DNA	0	0	77	164	0		X
50616	A3T3 DNA	0	0	77	78	0		X
50617	MeC9 DNA	0	0	77	78	0		X
50760	1H, 13C,15N and 31P chemical shift assignment of the stem-loop 4 from the 5'-UTR of SARS-CoV-2	204	69	24	228	0			X
51137	Assignment of base 15N and 1H chemical shifts for <5_SL5C>	80	4	11	115	0			X
51138	Assignment of base 15N and 1H chemical shifts for <5_SL5B_GC>	261	118	19	322	0			X