| Entry ID | Original Release date | Data summary | Entry Title | Citation Title | Authors |
|---|---|---|---|---|---|
| 52586 | 2024-11-15 | Chemical Shifts: 1 set |
Histone H4 Tail with Uniform Lysine Acetylation |
Acetylation-Dependent Compaction of the Histone H4 Tail Ensemble
|
Emma J Kraft, Jeetain Mittal, Scott A Showalter, Sophia M Dewing, Tien M Phan |
| 52585 | 2024-11-15 | Chemical Shifts: 1 set |
Histone H4 tail |
Acetylation-Dependent Compaction of the Histone H4 Tail Ensemble
|
Emma J Kraft, Jeetain Mittal, Scott A Showalter, Sophia M Dewing, Tien M Phan |
| 51512 | 2023-06-30 | Chemical Shifts: 1 set |
Backbone 1H, 13C, and 15N chemical shift assignments for the chromoshadow domain (residue 112-176) of human heterochromatin protein 1a (HP1a). |
Molecular interactions underlying the phase separation of HP1a: role of phosphorylation, ligand and nucleic acid binding
|
Azamat Rizuan, Bryce E Ackermann, Cheenou Her, Galia T Debelouchina, Jeetain Mittal, Nina Jovic, Tien M Phan, Utkarsh Kapoor, Young Kim |
| 30933 | 2021-08-09 | Chemical Shifts: 1 set |
Solution NMR Structure of [Ala19]Crp4 |
A conserved beta-bulge glycine residue facilitates folding and increases stability of the mouse alpha-defensin cryptdin-4
|
A C Conibear, A J Ouellette, A Song, K J Rosengren, R J Clark, T H Phan |
| 30934 | 2021-08-09 | Chemical Shifts: 1 set |
Solution NMR Structure of [D-Ala19]Crp4 |
A conserved beta-bulge glycine residue facilitates folding and increases stability of the mouse alpha-defensin cryptdin-4
|
A C Conibear, A J Ouellette, A Song, K J Rosengren, R J Clark, T H Phan |
| 36390 | 2025-10-24 | Chemical Shifts: 1 set |
Left-handed G-quadruplex containing 3 bulges |
Bulges in left-handed G-quadruplexes.
|
Anh Tuan T Phan, Arijit Maity, Blaz Bakalar, Emmanuelle Schmitt, Fernaldo R Winnerdy, Khac Huy H Ngo, Poulomi Das, Yves Mechulam |
| 36375 | 2025-10-24 | Chemical Shifts: 1 set |
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 |
Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.
|
Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim |
| 36374 | 2025-10-24 | Chemical Shifts: 1 set |
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1 |
Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.
|
Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim |
| 50381 | 2021-10-10 | Chemical Shifts: 1 set Molecule Interaction Chemical Shift Values: 2 sets |
The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation |
The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation
|
Brad A Palanski, Daniel R Dempsey, Eunyoung Park, Haribabu Arthanari, Jeffrey J Gray, Jeliazko R Jeliazkov, Kim L Phan, Michael J Eck, Paul Coote, Philip A Cole, Reina Iwase, Sandra B Gabelli, Stephanie Henriquez, Thibault Viennet, Zan Chen |
| 27989 | 2019-11-25 | Chemical Shifts: 1 set |
Backbone and side-chain chemical shift assignments of the ribosome-inactivating protein trichobakin (TBK) in solution |
Backbone and side-chain chemical shift assignments for the ribosome-inactivating protein trichobakin (TBK)
|
Alexander S Arseniev, Anatoly S Urban, Chi Van Phan, Dmitry M Lesovoy, Eduard V Bocharov, Elena V Britikova, Sergey A Usanov, Thi Bich Thao Le, Vladimir V Britikov |
| 36203 | 2025-09-27 | Chemical Shifts: 1 set |
Structure of a G-quadruplex |
Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter.
|
Anh Tuan T Phan, Anjali Sengar, Fernaldo R Winnerdy, J Jeya J Vandana, Marco Di Antonio, Shankar Balasubramanian, Vicki S Chambers |
| 34302 | 2018-10-12 | Chemical Shifts: 1 set |
The major G-quadruplex form of HIV-1 LTR |
Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop
|
A T Phan, B Bakalar, B Heddi, E Butovskaya, S N Richter |
| 30475 | 2019-05-07 | Chemical Shifts: 1 set |
Solution structure of ZmD32 |
Salt-Tolerant Antifungal and Antibacterial Activities of the Corn Defensin ZmD32.
|
Bomai K Kerenga, David J Craik, Donovan Garcia-Ceron, Fung T Lay, James A McKenna, Kathy Parisi, Marilyn A Anderson, Mark D Hulett, Mark R Bleackley, Nicole L van der Weerden, Pedro Quimbar, Peta J Harvey, Prem K Veneer, Shaily Vasa, Thanh Kha K Phan, Thomas Shafee |
| 25746 | 2016-05-31 | Chemical Shifts: 1 set |
G-quadruplex structure |
G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding
|
Anh Tuan Phan, Brahim Heddi, Nerea Martin-Pintado, Teuku Kari, Zhalgas Serimbetov |
| 25582 | 2015-07-27 | Chemical Shifts: 1 set |
structure of a protein |
Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex
|
Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong |
| 25686 | 2016-06-27 | Chemical Shifts: 1 set |
Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome |
Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome
|
Anh Tuan Phan, Beatrice de Nicola, Brahim Heddi, Christopher Jacques Lech, Sagar Regmi, Sara Richter |
| 25651 | 2016-07-05 | Chemical Shifts: 1 set |
Isolation and structural characterization of an active G-quadruplex motif from AGRO100 |
Isolation and structural characterization of an active G-quadruplex motif from AGRO100
|
Anh Tuan Phan, Brahim Heddi, Wan Jun Chung |
| 25548 | 2015-07-27 | Chemical Shifts: 1 set |
structure of a peptide |
Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex
|
Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong |
| 25378 | 2015-10-12 | Chemical Shifts: 1 set |
A structure of G-quadruplex |
Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad
|
Anh Tuan AT Phan, Brahim Heddi, Christopher CJ Lech, Vee Vee VV Cheong |
| 25278 | 2014-11-11 | Chemical Shifts: 1 set |
Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS. Seattle Structural Genomics Center for Infectious Disease target BupsA.00863.i. |
Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS - An "invisible" dimer interface.
|
Garry W Buchko, Isabelle Phan, Peter J Myler, Samuel I Miller, Stephen N Hewitt, Thomas E Edwards, Wesley C Van Voorhis |
| 25110 | 2015-02-16 | Chemical Shifts: 1 set |
Solution structure of a left-handed G-quadruplex |
Structure of a left-handed DNA G-quadruplex
|
Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam |
| 19594 | 2014-01-21 | Chemical Shifts: 1 set |
Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 |
Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3.
|
Anh Tuan Phan, Brahim Heddi, Florian Hamon, Marie-Paule Teulade-Fichou, Wan Jun Chung |
| 19402 | 2013-09-16 | Chemical Shifts: 1 set |
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) |
Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng |
| 19389 | 2014-05-27 | Chemical Shifts: 1 set |
Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite |
Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite
|
Alain Nicolas, Anh Tuan Phan, Brahim Heddi, Christopher J Lech, Ding Jie Ang, Michael Adrian |
| 19386 | 2014-12-01 | Chemical Shifts: 1 set |
parallel-stranded G-quadruplex in DNA poly-G stretches |
Formation of G-quadruplexes in poly-G sequences: Structure of a propeller-type parallel-stranded G-quadruplex formed by a G15 stretch
|
Anh Tuan Phan, Anjali Sengar, Brahim Heddi |
| 19387 | 2013-08-26 | Chemical Shifts: 1 set |
Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative |
Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative.
|
Anh Tuan Phan, Brahim Heddi, Kazuo Nagasawa, Keisuke Iida, Masayuki Tera, Wan Jun Chung |
| 19381 | 2015-02-02 | Chemical Shifts: 1 set |
Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes |
Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes
|
Anh Tuan Phan, Brahim Heddi, Christopher Lech, Michael Adrian, Zhe Li |
| 19279 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19277 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19278 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19276 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[CGCGAAGCATTCGCG] hairpin |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19280 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19281 | 2013-07-08 | Chemical Shifts: 1 set |
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19017 | 2013-05-30 | Chemical Shifts: 1 set |
Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge |
Bulges in g-quadruplexes: broadening the definition of g-quadruplex-forming sequences.
|
Anh Tuan Phan, Vineeth Thachappilly Mukundan |
| 18847 | 2013-03-01 | Chemical Shifts: 1 set |
Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution |
Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution.
|
Anh Tuan Phan, Herry Martadinata |
| 18707 | 2014-03-10 | Chemical Shifts: 1 set |
Solution structure of TamA POTRA domain I |
The C-terminal beta-signal-like motif of TamB facilitates efficient autotransporter secretion.
|
Joel Selkrig, Mark Schembri, Martin Scanlon, Matthew Belousoff, Minh-Duy Phan, Nermin Celik, Stephen Headey, Trevor Lithgow |
| 18279 | 2012-03-22 | Chemical Shifts: 1 set |
human CEB25 minisatellite G-quadruplex |
Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite.
|
Alain Nicolas, Alexandre Serero, Anh Tuan Phan, Brahim Heddi, Jean-Louis Mergny, Michael Adrian, Samir Amrane |
| 18016 | 2011-11-29 | Chemical Shifts: 1 set |
Solution structure of MSMEG_1053, the second DUF3349 annotated protein in the genome of Mycobacterium smegmatis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MysmA.17112.b |
Different structures for two DUF3349 annotated proteins in the genome of Mycobacterium smegmatis suggest a structural diversity within the DUF3349 superfamily.
|
Alberto J Napuli, Chang-Yub Kim, Garry W Buchko, Isabelle Phan, Jan Abendroth, Peter J Myler, Stephen N Hewitt, Thomas E Edwards, Wesley C Van Voorhis |
| 17980 | 2012-10-09 | Chemical Shifts: 1 set |
Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study |
Monomer-dimer equilibrium for the 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study.
|
Anh Tuan Phan, Ngoc Quang Do |
| 17697 | 2011-08-19 | Chemical Shifts: 1 set |
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface |
Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do |
| 17655 | 2011-08-02 | Chemical Shifts: 1 set |
Structure of Human Telomeric DNA in Crowded Solution |
Structure of Human Telomeric DNA in Crowded Solution
|
Anh Tuan Phan, Brahim Heddi |
| 17504 | 2011-06-07 | Chemical Shifts: 1 set |
RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide |
Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction.
|
Alexander Serganov, Ananya Majumdar, Anh Tuan Phan, Anna Polonskaia, Cynthia Chen, David Clain, Dinshaw J Patel, Jennifer C Darnell, Robert B Darnell, Serge Ilin, Tanya Raslin, Vitaly Kuryavyi |
| 16774 | 2010-03-22 | Chemical Shifts: 1 set |
Solution structure of the Mycobacterium tuberculosis protein Rv0543c, a member of the DUF3349 superfamily. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17112.a |
Inaugural structure from the DUF3349 superfamily of proteins, Mycobacterium tuberculosis Rv0543c.
|
Chang-Yub Kim, Garry W Buchko, Isabelle Phan, Peter J Myler, Thomas C Terwilliger |
| 6430 | 2009-07-06 | Chemical Shifts: 1 set |
1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del |
An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase
|
Anh Tuan Phan, Aurelie Faure, Dinshaw J Patel, Jin-Biao Ma, Marie-Line Andreola, Vitaly Kuryavyi |
| 4692 | 2001-03-02 | Chemical Shifts: 3 sets |
SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT |
The solution structure and internal motions of a fragment of the cytidine-rich strand of the human telomere
|
A T Phan, J L Leroy, M Gueron |
| 4213 | 2000-03-10 | Chemical Shifts: 1 set |
Retro-inverso analogue of G-H loop of VP1 in FMD virus |
Solution structure of a retro-inverso peptide analogue mimicking the foot-and-mouth disease virus major antigenic site. Structural basis for its antigenic cross-reactivity with the parent peptide.
|
A Phan Chan Du, G Guichard, J P Briand, M C Petit, M T Cung, N Benkirane, S Muller |
| 4212 | 2000-02-23 | Chemical Shifts: 1 set |
Synthetic peptide corresponding to the major immunogen site of FMD virus |
Solution structure of a retro-inverso peptide analogue mimicking the foot-and-mouth disease virus major antigenic site : structural basis for its antigenic crossreactivity with the parent peptide
|
A Phan Chan Du, G Guichard, J P Briand, M C Petit, M Marraud, M T Cung, N Benkirane, S Muller |