Instant search results.

47 results found. These results are sorted by relevance. You can sort the results by clicking on the table headers.

Download citations for all displayed entries in BibTeX format
Entry ID Original Release date Data summary Entry Title Citation Title Authors
52586 2024-11-15 Chemical Shifts: 1 set
Histone H4 Tail with Uniform Lysine Acetylation Acetylation-Dependent Compaction of the Histone H4 Tail Ensemble Download bibtex for citation iamge Emma J Kraft, Jeetain Mittal, Scott A Showalter, Sophia M Dewing, Tien M Phan
52585 2024-11-15 Chemical Shifts: 1 set
Histone H4 tail Acetylation-Dependent Compaction of the Histone H4 Tail Ensemble Download bibtex for citation iamge Emma J Kraft, Jeetain Mittal, Scott A Showalter, Sophia M Dewing, Tien M Phan
51512 2023-06-30 Chemical Shifts: 1 set
Backbone 1H, 13C, and 15N chemical shift assignments for the chromoshadow domain (residue 112-176) of human heterochromatin protein 1a (HP1a). Molecular interactions underlying the phase separation of HP1a: role of phosphorylation, ligand and nucleic acid binding Download bibtex for citation iamge Azamat Rizuan, Bryce E Ackermann, Cheenou Her, Galia T Debelouchina, Jeetain Mittal, Nina Jovic, Tien M Phan, Utkarsh Kapoor, Young Kim
30933 2021-08-09 Chemical Shifts: 1 set
Solution NMR Structure of [Ala19]Crp4 A conserved beta-bulge glycine residue facilitates folding and increases stability of the mouse alpha-defensin cryptdin-4 Download bibtex for citation iamge A C Conibear, A J Ouellette, A Song, K J Rosengren, R J Clark, T H Phan
30934 2021-08-09 Chemical Shifts: 1 set
Solution NMR Structure of [D-Ala19]Crp4 A conserved beta-bulge glycine residue facilitates folding and increases stability of the mouse alpha-defensin cryptdin-4 Download bibtex for citation iamge A C Conibear, A J Ouellette, A Song, K J Rosengren, R J Clark, T H Phan
36390 2025-10-24 Chemical Shifts: 1 set
Left-handed G-quadruplex containing 3 bulges Bulges in left-handed G-quadruplexes. Download bibtex for citation iamge Anh Tuan T Phan, Arijit Maity, Blaz Bakalar, Emmanuelle Schmitt, Fernaldo R Winnerdy, Khac Huy H Ngo, Poulomi Das, Yves Mechulam
36375 2025-10-24 Chemical Shifts: 1 set
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. Download bibtex for citation iamge Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim
36374 2025-10-24 Chemical Shifts: 1 set
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1 Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. Download bibtex for citation iamge Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim
50381 2021-10-10 Chemical Shifts: 1 set
Molecule Interaction Chemical Shift Values: 2 sets
The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation The Structural Basis of PTEN Regulation by Multi-Site Phosphorylation Download bibtex for citation iamge Brad A Palanski, Daniel R Dempsey, Eunyoung Park, Haribabu Arthanari, Jeffrey J Gray, Jeliazko R Jeliazkov, Kim L Phan, Michael J Eck, Paul Coote, Philip A Cole, Reina Iwase, Sandra B Gabelli, Stephanie Henriquez, Thibault Viennet, Zan Chen
27989 2019-11-25 Chemical Shifts: 1 set
Backbone and side-chain chemical shift assignments of the ribosome-inactivating protein trichobakin (TBK) in solution Backbone and side-chain chemical shift assignments for the ribosome-inactivating protein trichobakin (TBK) Download bibtex for citation iamge Alexander S Arseniev, Anatoly S Urban, Chi Van Phan, Dmitry M Lesovoy, Eduard V Bocharov, Elena V Britikova, Sergey A Usanov, Thi Bich Thao Le, Vladimir V Britikov
36203 2025-09-27 Chemical Shifts: 1 set
Structure of a G-quadruplex Structure of a (3+1) hybrid G-quadruplex in the PARP1 promoter. Download bibtex for citation iamge Anh Tuan T Phan, Anjali Sengar, Fernaldo R Winnerdy, J Jeya J Vandana, Marco Di Antonio, Shankar Balasubramanian, Vicki S Chambers
34302 2018-10-12 Chemical Shifts: 1 set
The major G-quadruplex form of HIV-1 LTR Major G-Quadruplex Form of HIV-1 LTR Reveals a (3 + 1) Folding Topology Containing a Stem-Loop Download bibtex for citation iamge A T Phan, B Bakalar, B Heddi, E Butovskaya, S N Richter
30475 2019-05-07 Chemical Shifts: 1 set
Solution structure of ZmD32 Salt-Tolerant Antifungal and Antibacterial Activities of the Corn Defensin ZmD32. Download bibtex for citation iamge Bomai K Kerenga, David J Craik, Donovan Garcia-Ceron, Fung T Lay, James A McKenna, Kathy Parisi, Marilyn A Anderson, Mark D Hulett, Mark R Bleackley, Nicole L van der Weerden, Pedro Quimbar, Peta J Harvey, Prem K Veneer, Shaily Vasa, Thanh Kha K Phan, Thomas Shafee
25746 2016-05-31 Chemical Shifts: 1 set
G-quadruplex structure G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triadwater complex and implication for small-molecule binding Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Nerea Martin-Pintado, Teuku Kari, Zhalgas Serimbetov
25582 2015-07-27 Chemical Shifts: 1 set
structure of a protein Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex Download bibtex for citation iamge Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong
25686 2016-06-27 Chemical Shifts: 1 set
Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome Structure of a G-quadruplex in the Long Terminal Repeat of the proviral HIV-1 genome Download bibtex for citation iamge Anh Tuan Phan, Beatrice de Nicola, Brahim Heddi, Christopher Jacques Lech, Sagar Regmi, Sara Richter
25651 2016-07-05 Chemical Shifts: 1 set
Isolation and structural characterization of an active G-quadruplex motif from AGRO100 Isolation and structural characterization of an active G-quadruplex motif from AGRO100 Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Wan Jun Chung
25548 2015-07-27 Chemical Shifts: 1 set
structure of a peptide Insights into G-quadruplex specific recognition by the DEAH-box helicase RHAU: Solution structure of a peptide-quadruplex complex Download bibtex for citation iamge Anh Tuan AT Phan, Brahim Heddi, Herry Martadinata, Vee Vee VV Cheong
25378 2015-10-12 Chemical Shifts: 1 set
A structure of G-quadruplex Xanthine and 8-oxoguanine in G-quadruplexes: formation of a GGXO tetrad Download bibtex for citation iamge Anh Tuan AT Phan, Brahim Heddi, Christopher CJ Lech, Vee Vee VV Cheong
25278 2014-11-11 Chemical Shifts: 1 set
Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS. Seattle Structural Genomics Center for Infectious Disease target BupsA.00863.i. Backbone chemical shift assignments for the sensor domain of the Burkholderia pseudomallei histidine kinase RisS - An "invisible" dimer interface. Download bibtex for citation iamge Garry W Buchko, Isabelle Phan, Peter J Myler, Samuel I Miller, Stephen N Hewitt, Thomas E Edwards, Wesley C Van Voorhis
25110 2015-02-16 Chemical Shifts: 1 set
Solution structure of a left-handed G-quadruplex Structure of a left-handed DNA G-quadruplex Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam
19594 2014-01-21 Chemical Shifts: 1 set
Solution structure of a G-quadruplex bound to the bisquinolinium compound Phen-DC3 Solution Structure of a G-quadruplex Bound to the Bisquinolinium Compound Phen-DC3. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Florian Hamon, Marie-Paule Teulade-Fichou, Wan Jun Chung
19402 2013-09-16 Chemical Shifts: 1 set
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng
19389 2014-05-27 Chemical Shifts: 1 set
Solution structure of a stacked dimeric G-quadruplex formed by a segment of the human CEB1 minisatellite Structure and Conformational Dynamics of a Stacked Dimeric G-Quadruplex Formed by the Human CEB1 Minisatellite Download bibtex for citation iamge Alain Nicolas, Anh Tuan Phan, Brahim Heddi, Christopher J Lech, Ding Jie Ang, Michael Adrian
19386 2014-12-01 Chemical Shifts: 1 set
parallel-stranded G-quadruplex in DNA poly-G stretches Formation of G-quadruplexes in poly-G sequences: Structure of a propeller-type parallel-stranded G-quadruplex formed by a G15 stretch Download bibtex for citation iamge Anh Tuan Phan, Anjali Sengar, Brahim Heddi
19387 2013-08-26 Chemical Shifts: 1 set
Solution structure of an intramolecular (3+1) human telomeric G-quadruplex bound to a telomestatin derivative Solution structure of an intramolecular (3 + 1) human telomeric g-quadruplex bound to a telomestatin derivative. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kazuo Nagasawa, Keisuke Iida, Masayuki Tera, Wan Jun Chung
19381 2015-02-02 Chemical Shifts: 1 set
Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes Engineering G4: Towards effective incorporation of locked nucleic acid into G-quadruplexes Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Christopher Lech, Michael Adrian, Zhe Li
19280 2013-07-08 Chemical Shifts: 1 set
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19277 2013-07-08 Chemical Shifts: 1 set
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19278 2013-07-08 Chemical Shifts: 1 set
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19276 2013-07-08 Chemical Shifts: 1 set
Structure of d[CGCGAAGCATTCGCG] hairpin Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19279 2013-07-08 Chemical Shifts: 1 set
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19281 2013-07-08 Chemical Shifts: 1 set
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19017 2013-05-30 Chemical Shifts: 1 set
Solution structure of an intramolecular propeller-type G-quadruplex containing a single bulge Bulges in g-quadruplexes: broadening the definition of g-quadruplex-forming sequences. Download bibtex for citation iamge Anh Tuan Phan, Vineeth Thachappilly Mukundan
18847 2013-03-01 Chemical Shifts: 1 set
Structure of stacked G-quadruplex formed by human TERRA sequence in potassium solution Structure of Human Telomeric RNA (TERRA): Stacking of Two G-Quadruplex Blocks in K(+) Solution. Download bibtex for citation iamge Anh Tuan Phan, Herry Martadinata
18707 2014-03-10 Chemical Shifts: 1 set
Solution structure of TamA POTRA domain I The C-terminal beta-signal-like motif of TamB facilitates efficient autotransporter secretion. Download bibtex for citation iamge Joel Selkrig, Mark Schembri, Martin Scanlon, Matthew Belousoff, Minh-Duy Phan, Nermin Celik, Stephen Headey, Trevor Lithgow
18279 2012-03-22 Chemical Shifts: 1 set
human CEB25 minisatellite G-quadruplex Formation of pearl-necklace monomorphic G-quadruplexes in the human CEB25 minisatellite. Download bibtex for citation iamge Alain Nicolas, Alexandre Serero, Anh Tuan Phan, Brahim Heddi, Jean-Louis Mergny, Michael Adrian, Samir Amrane
18016 2011-11-29 Chemical Shifts: 1 set
Solution structure of MSMEG_1053, the second DUF3349 annotated protein in the genome of Mycobacterium smegmatis. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MysmA.17112.b Different structures for two DUF3349 annotated proteins in the genome of Mycobacterium smegmatis suggest a structural diversity within the DUF3349 superfamily. Download bibtex for citation iamge Alberto J Napuli, Chang-Yub Kim, Garry W Buchko, Isabelle Phan, Jan Abendroth, Peter J Myler, Stephen N Hewitt, Thomas E Edwards, Wesley C Van Voorhis
17980 2012-10-09 Chemical Shifts: 1 set
Monomer-dimer equilibrium for 5 -5 stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study Monomer-dimer equilibrium for the 5'-5' stacking of propeller-type parallel-stranded G-quadruplexes: NMR structural study. Download bibtex for citation iamge Anh Tuan Phan, Ngoc Quang Do
17697 2011-08-19 Chemical Shifts: 1 set
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do
17655 2011-08-02 Chemical Shifts: 1 set
Structure of Human Telomeric DNA in Crowded Solution Structure of Human Telomeric DNA in Crowded Solution Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi
17504 2011-06-07 Chemical Shifts: 1 set
RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide Structure-function studies of FMRP RGG peptide recognition of an RNA duplex-quadruplex junction. Download bibtex for citation iamge Alexander Serganov, Ananya Majumdar, Anh Tuan Phan, Anna Polonskaia, Cynthia Chen, David Clain, Dinshaw J Patel, Jennifer C Darnell, Robert B Darnell, Serge Ilin, Tanya Raslin, Vitaly Kuryavyi
16774 2010-03-22 Chemical Shifts: 1 set
Solution structure of the Mycobacterium tuberculosis protein Rv0543c, a member of the DUF3349 superfamily. Seattle Structural Genomics Center for Infectious Disease (SSGCID) target MytuD.17112.a Inaugural structure from the DUF3349 superfamily of proteins, Mycobacterium tuberculosis Rv0543c. Download bibtex for citation iamge Chang-Yub Kim, Garry W Buchko, Isabelle Phan, Peter J Myler, Thomas C Terwilliger
6430 2009-07-06 Chemical Shifts: 1 set
1H and 31P chemical shift assignments for HIV-1 integrase inhibitor 93del An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase Download bibtex for citation iamge Anh Tuan Phan, Aurelie Faure, Dinshaw J Patel, Jin-Biao Ma, Marie-Line Andreola, Vitaly Kuryavyi
4692 2001-03-02 Chemical Shifts: 3 sets
SOLUTION STRUCTURE OF A HUMAN TELOMERE FRAGMENT The solution structure and internal motions of a fragment of the cytidine-rich strand of the human telomere Download bibtex for citation iamge A T Phan, J L Leroy, M Gueron
4213 2000-03-10 Chemical Shifts: 1 set
Retro-inverso analogue of G-H loop of VP1 in FMD virus Solution structure of a retro-inverso peptide analogue mimicking the foot-and-mouth disease virus major antigenic site. Structural basis for its antigenic cross-reactivity with the parent peptide. Download bibtex for citation iamge A Phan Chan Du, G Guichard, J P Briand, M C Petit, M T Cung, N Benkirane, S Muller
4212 2000-02-23 Chemical Shifts: 1 set
Synthetic peptide corresponding to the major immunogen site of FMD virus Solution structure of a retro-inverso peptide analogue mimicking the foot-and-mouth disease virus major antigenic site : structural basis for its antigenic crossreactivity with the parent peptide Download bibtex for citation iamge A Phan Chan Du, G Guichard, J P Briand, M C Petit, M Marraud, M T Cung, N Benkirane, S Muller