Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36374
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Tan, Derrick; Winnerdy, Fernaldo; Lim, Kah Wai; Phan, Anh Tuan. "Coexistence of two quadruplex-duplex hybrids in the PIM1 gene." Nucleic Acids Res. 48, 11162-11171 (2020).
PubMed: 32976598
Assembly members:
PIM1 promoter, Form 1, polymer, 27 residues, 8506.419 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
PIM1 promoter, Form 1: GCGGGAGGGCGCGCCAGCGG
GGTCGGG
| Data type | Count |
| 1H chemical shifts | 209 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 27 residues - 8506.419 Da.
| 1 | DG | DC | DG | DG | DG | DA | DG | DG | DG | DC | ||||
| 2 | DG | DC | DG | DC | DC | DA | DG | DC | DG | DG | ||||
| 3 | DG | DG | DT | DC | DG | DG | DG |
sample_H2O: GC-PIM1 2 mM; KCl 70 mM; potassium phosphate 20 mM; DSS 50 uM; H2O 90%; D2O, [U-2H], 10%
sample_D2O: GC-PIM1 2 mM; KCl 70 mM; potassium phosphate 20 mM; DSS 50 uM; D2O, [U-2H], 100%
sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_H2O | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_D2O | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_D2O | isotropic | sample_conditions_1 |
TopSpin v2.1, Bruker Biospin - collection
TopSpin v4.0, Bruker Biospin - processing
NMRFAM-SPARKY, Lee, Tonelli, Markley - peak picking
NMRFAM-SPARKY, Lee, Tonelli, Markley - chemical shift assignment
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement