Instant search results.

11 results found. These results are sorted by relevance. You can sort the results by clicking on the table headers.

Download citations for all displayed entries in BibTeX format
Entry ID Original Release date Data summary Entry Title Citation Title Authors
36374 2025-10-24 Chemical Shifts: 1 set
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1 Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. Download bibtex for citation iamge Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim
36375 2025-10-24 Chemical Shifts: 1 set
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 Coexistence of two quadruplex-duplex hybrids in the PIM1 gene. Download bibtex for citation iamge Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim
25110 2015-02-16 Chemical Shifts: 1 set
Solution structure of a left-handed G-quadruplex Structure of a left-handed DNA G-quadruplex Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam
19402 2013-09-16 Chemical Shifts: 1 set
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng
19279 2013-07-08 Chemical Shifts: 1 set
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19276 2013-07-08 Chemical Shifts: 1 set
Structure of d[CGCGAAGCATTCGCG] hairpin Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19278 2013-07-08 Chemical Shifts: 1 set
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19280 2013-07-08 Chemical Shifts: 1 set
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19281 2013-07-08 Chemical Shifts: 1 set
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
19277 2013-07-08 Chemical Shifts: 1 set
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid Structural basis of DNA quadruplex-duplex junction formation. Download bibtex for citation iamge Anh Tuan Phan, Kah Wai Lim
17697 2011-08-19 Chemical Shifts: 1 set
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity. Download bibtex for citation iamge Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do