| Entry ID |
Original Release date |
Data summary |
Entry Title |
Citation Title |
Authors |
| 36374 |
2025-10-24 |
Chemical Shifts: 1 set |
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 1 |
Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.
|
Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim |
| 36375 |
2025-10-24 |
Chemical Shifts: 1 set |
Quadruplex-duplex hybrid structure in the PIM1 gene, Form 2 |
Coexistence of two quadruplex-duplex hybrids in the PIM1 gene.
|
Anh Tuan T Phan, Derrick JY Tan, Fernaldo R Winnerdy, Kah Wai W Lim |
| 25110 |
2015-02-16 |
Chemical Shifts: 1 set |
Solution structure of a left-handed G-quadruplex |
Structure of a left-handed DNA G-quadruplex
|
Anh Tuan Phan, Brahim Heddi, Emmanuelle Schmitt, Kah Wai Lim, Wan Jun Chung, Yves Mechulam |
| 19402 |
2013-09-16 |
Chemical Shifts: 1 set |
Structure of an antiparallel (2+2) G-quadruplex formed by human telomeric repeats in Na+ solution (with G22-to-BrG substitution) |
Structure of the human telomere in Na+ solution: an antiparallel (2+2) G-quadruplex scaffold reveals additional diversity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Nerea Martin-Pintado, Veronica Chinn Min Ng |
| 19280 |
2013-07-08 |
Chemical Shifts: 1 set |
Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19276 |
2013-07-08 |
Chemical Shifts: 1 set |
Structure of d[CGCGAAGCATTCGCG] hairpin |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19278 |
2013-07-08 |
Chemical Shifts: 1 set |
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19279 |
2013-07-08 |
Chemical Shifts: 1 set |
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19281 |
2013-07-08 |
Chemical Shifts: 1 set |
Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 19277 |
2013-07-08 |
Chemical Shifts: 1 set |
Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] duplex-quadruplex hybrid |
Structural basis of DNA quadruplex-duplex junction formation.
|
Anh Tuan Phan, Kah Wai Lim |
| 17697 |
2011-08-19 |
Chemical Shifts: 1 set |
Structure of a dimeric all-parallel-stranded G-quadruplex stacked via the 5'-to-5' interface |
Stacking of G-quadruplexes: NMR structure of a G-rich oligonucleotide with potential anti-HIV and anticancer activity.
|
Anh Tuan Phan, Brahim Heddi, Kah Wai Lim, Ming Hoon Teo, Ngoc Quang Do |