Instant search results.

These results are sorted by relevance. You can sort the results by clicking on the table headers.

Entry ID	Original Release date	Data summary	Entry Title	Citation Title	Authors
34837	2023-11-11	Chemical Shifts: 1 set	Solution structure of the peptide U11-MYRTX-Tb1a from the venom of the ant Tetramorium bicarinatum	Discovery of an Insect Neuroactive Helix Ring Peptide from Ant Venom.	A Billet, A Dejean, A Touchard, B Lefranc, C Sivignon, E Bonnafe, F Calevro, F Paquet, G Boy, I Rahioui, J Leprince, K Gaget, K Loth, L Jouvensal, M Ribeiro Lopes, M Treilhou, P Da Silva, S Ascoet, V Barasse, V Lacotte
51692	2023-06-27	Chemical Shifts: 1 set	Sidechain Ile, Leu, and Val methyl Chemical Shift Assignments for Penicillin Binding Protein 5	Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5	Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal
51690	2023-06-27	Chemical Shifts: 1 set	Sequence Specific 1H, 13C, and 15N backbone resonance assignments of 70 kDa Penicillin Binding Protein PBP5	Molecular basis of b-lactam antibiotic resistance of ESKAPE bacterium E. faecium Penicillin Binding Protein PBP5	Andre Da Silva Santiago, Charlene Desbonnet, Everton D D'Andrea, Ganesan Senthil S Kumar, Louis B Rice, Marta V Schoenle, Meng S Choy, Michel Arthur, Rebecca Page, Wolfgang Peti, Yamanappa Hunashal
34742	2023-05-24	Chemical Shifts: 1 set	Solution NMR structure of AG41, a 41-amino acid insecticidal protein extracted from Medicago truncatula	Residues of Legume AG41 Peptide Crucial to Its Bio-Insecticidal Activity	Catherine Sivignon, Fatima Diya, Francine Rizk, Isabelle Rahioui, Karine Loth, Lamis Karaki, Laurence Jouvensal, Linda Kfoury, Pedro Da Silva
34667	2022-09-21	Chemical Shifts: 1 set	NMR solution structure of BCR4	Aphid BCR4 Structure and Activity Uncover a New Defensin Peptide Superfamily	Abdelaziz Heddi, Agnes F Delmas, Catherine Sivignon, Federica Calevro, Francoise Paquet, Gabrielle Duport, Hugo Terrasson, Isabelle Rahioui, Karen Gaget, Karine Loth, Melanie Ribeiro Lopes, Nicolas Parisot, Pedro da Silva, Vincent Aucagne
50741	2023-02-07	Chemical Shifts: 1 set	Backbone 1H, 15N and 13C chemical shift assignments for HEV ORF1 peptide [1622-1647] (isolate G3-HEV83-2-27) in 20% TFE-d2	Hepatitis E virus RNA-dependent RNA polymerase is involved in RNA replication and infectious particle production	Dagmara Szkolnicka, Darius Moradpour, Francois-Xavier X Cantrelle, Jerome Gouttenoire, Nathalie Da Silva, Noemie Oechslin, Xavier Hanoulle
30717	2020-11-27	Chemical Shifts: 1 set Spectral_peak_list: 1 set	Hs05 - Intragenic antimicrobial peptide	Characterization of novel human intragenic antimicrobial peptides, incorporation and release studies from ureasil-polyether hybrid matrix	A L Oliveira, A R Araujo, B Lira, C Bloch, E A Barbosa, E M Carmo da Silva, G D Brand, G H Mariano, J A Chaker, J L Cardozo Fh, J Leite, L G Gomes de Sa, M A Santos, M Ramada
34346	2019-12-06	Chemical Shifts: 1 set	NMR Structure of Big-defensin 1 from oyster Crassostrea gigas	The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets.	A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne
34345	2019-12-06	Chemical Shifts: 1 set	NMR Structure of Big-defensin 1 [44-93] from oyster Crassostrea gigas	The Ancestral N-Terminal Domain of Big Defensins Drives Bacterially Triggered Assembly into Antimicrobial Nanonets.	A Bressan, A F Delmas, A Vergnes, C Barreto, C Cazevielle, D Destoumieux-Garzon, E Bachere, H Marchandin, H Meudal, J Da Silva, K Loth, L Touqui, N Belmadi, P Bulet, R D Rosa, S N Voisin, V Aucagne
30058	2017-05-04	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30055	2017-04-06	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTTGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30056	2017-04-06	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution structure of d(GGTTTGGTTTTGGTTGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
30045	2017-03-30	Chemical Shifts: 1 set	DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
25512	2015-09-10	Chemical Shifts: 1 set	NMR structure of VirB9 C-terminal domain in complex with VirB7 N-terminal domain from Xanthomonas citri's T4SS.	VirB7 and VirB9 Interactions Are Required for the Assembly and Antibacterial Activity of a Type IV Secretion System	Chuck Shaker S Farah, Denize Cristina C Favaro, Diorge Paulo P Souza, Filipe da Silva Lima, Gabriel Umaji U Oka, Hans Wienk, Luciana Coutinho C Oliveira, Roberto Kopke K Salinas, Rolf Boelens, Ronaldo Junio J Oliveira
19834	2015-02-16	Chemical Shifts: 1 set	New Cyt-like delta-endotoxins from Dickeya dadantii - CytC protein	New Cyt-like delta-endotoxins from Dickeya dadantii : structure and aphicidal activity	Celine Landon, Denis Costechareyre, Geraldine Effantin, Guy Contdemine, Karine Loth, Pedro Da Silva, Yvan Rahbe
19572	2014-10-27	Chemical Shifts: 1 set	Solution NMR structure of quadruplex d(TGGGTTTGGGTTGGGTTTGGG) in sodium conditions.	In preparation	Andreas Ioannis Karsisiotis, Mateus Webba da Silva, Paul Dillon
19571	2014-10-20	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGTTTTGGGTGGGTTTTGGG) quadruplex in sodium conditions.	Encoding canonical DNA quadruplex structure.	Andreas I Karsisiotis, Mateus Webba da Silva, Scarlett A Dvorkin
19158	2014-04-16	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGTTGGGTTTTGGGTGGG) quadruplex in sodium conditions	DNA quadruplex folding formalism--a tutorial on quadruplex topologies.	Andreas Ioannis Karsisiotis, Christopher Webba da Silva
19159	2014-04-16	Chemical Shifts: 2 sets	Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions	DNA quadruplex folding formalism--a tutorial on quadruplex topologies.	Andreas Ioannis Karsisiotis, Christopher Webba da Silva
17709	2012-03-09	Chemical Shifts: 1 set	Solution-state structures of monomeric and dimeric G-quadruplexes formed by a sequence from N-myc	Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene.	Janez Plavec, Marko Trajkovski, Mateus Webba da Silva
17708	2012-03-09	Chemical Shifts: 1 set	Solution-state structures of monomeric and dimeric G-quadruplexes adopted by a sequence from N-myc	Unique Structural Features of Interconverting Monomeric and Dimeric G-Quadruplexes Adopted by a Sequence from the Intron of the N-myc Gene.	Janez Plavec, Marko Trajkovski, Mateus Webba da Silva
5494	2002-08-22	Chemical Shifts: 3 sets	NMR Structure of PW2 Bound to SDS Micelles: A Tryptophan-rich Anticocidial Peptide Selected from Phage Display Libraries	NMR Structure of PW2 bound to SDS Micelles. A Tryptophan-rich Anticocidial Peptide selected from Phage Display Libraries	A da Silva, A Leite, A P Valente, F C Almeida, L W Tinoco