Click here to enlarge.
PDB ID: 6fc9
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34221
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Diaz-Casado, Laura; Serrano-Chacon, Israel; Montalvillo-Jimenez, Laura; Corzana, Francisco; Bastida, Agatha; Santana, Andres; Gonzalez, Carlos; Asensio, Juan Luis. "De Novo Design of Selective Quadruplex-Duplex Junction Ligands and Structural Characterisation of Their Binding Mode: Targeting the G4 Hot-Spot" Chemistry 27, 6204-6212 (2021).
PubMed: 33368678
Assembly members:
entity_1, polymer, 27 residues, 8445.403 Da.
entity_D5B, non-polymer, 236.312 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGTTGGCGCGAAGCATTCGC
GGGTTGG
Data type | Count |
1H chemical shifts | 233 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
2 | entity_2 | 2 |
Entity 1, entity_1 27 residues - 8445.403 Da.
1 | DG | DG | DT | DT | DG | DG | DC | DG | DC | DG | ||||
2 | DA | DA | DG | DC | DA | DT | DT | DC | DG | DC | ||||
3 | DG | DG | DG | DT | DT | DG | DG |
Entity 2, entity_2 - C16 H16 N2 - 236.312 Da.
1 | D5B |