BMRB Entry 30510
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30510
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pham, V.; Salguero, C.; Khan, S.; Meagher, J.; Brown, W.; Humbert, N.; de Rocquigny, H.; Smith, J.; D'Souza, V.. "HIV-1 Tat interactions with cellular 7SK and viral TAR RNAs identifies dual structural mimicry" Nat. Commun. 9, 4266-4266 (2018).
PubMed: 30323330
Assembly members:
entity_1, polymer, 30 residues, 9652.762 Da.
entity_2, polymer, 17 residues, 2162.533 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCAGAUUGAGCCUGGGAG
CUCUCUGCCC
entity_2: GISYGRKKRRQRRRAHQ
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 120 |
| 15N chemical shifts | 20 |
| 1H chemical shifts | 307 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entities:
Entity 1, entity_1 30 residues - 9652.762 Da.
| 1 | G | G | G | C | A | G | A | U | U | G | |
| 2 | A | G | C | C | U | G | G | G | A | G | |
| 3 | C | U | C | U | C | U | G | C | C | C |
Entity 2, entity_2 17 residues - 2162.533 Da.
| 1 | GLY | ILE | SER | TYR | GLY | ARG | LYS | LYS | ARG | ARG | ||||
| 2 | GLN | ARG | ARG | ARG | ALA | HIS | GLN |
Samples:
sample_1: TAR RNA 0.5 ± 0.1 mM; Tat RNA Binding Domain 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_2: TAR RNA, [U-13C; U-15N], 0.5 ± 0.1 mM; Tat RNA Binding Domain 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_3: TAR RNA 0.5 ± 0.1 mM; Tat RNA Binding Domain 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_4: TAR RNA 0.5 ± 0.1 mM; Tat RNA Binding Domain, [U-13C; U-15N], 0.5 ± 0.1 mM; NaCl 10 mM; NaCl 70 mM; EDTA 0.1 mM
sample_conditions_1: ionic strength: 80 mM; pH: 5.4; pressure: 100000 Pa; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_4 | anisotropic | sample_conditions_1 |
Software:
TOPSPIN, Bruker Biospin - collection
NMRView, Johnson, One Moon Scientific - chemical shift assignment, peak picking
CYANA, Guntert, Mumenthaler and Wuthrich - data analysis, processing, structure calculation
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement
NMR spectrometers:
- Bruker DMX 700 MHz