Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30452
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Shortridge, M.; Wille, P.; Jones, A.; Davidson, A.; Bogdanovic, J.; Arts, E.; Karn, J.; Robinson, J.; Varani, G.. "An ultra-high affinity ligand of HIV-1 TAR reveals the RNA structure recognized by P-TEFb
" Nucleic Acids Res. 47, 1523-1531 (2019).
PubMed: 30481318
Assembly members:
entity_1, polymer, 14 residues, 1697.087 Da.
entity_2, polymer, 29 residues, 9307.555 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: synthetic construct
Entity Sequences (FASTA):
entity_1: XVRTRKGRRIXIXP
entity_2: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
| Data type | Count |
| 13C chemical shifts | 171 |
| 15N chemical shifts | 11 |
| 1H chemical shifts | 338 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entity 1, entity_1 14 residues - 1697.087 Da.
| 1 | DAB | VAL | ARG | THR | ARG | LYS | GLY | ARG | ARG | ILE | ||||
| 2 | 4J5 | ILE | DPR | PRO |
Entity 2, entity_2 29 residues - 9307.555 Da.
| 1 | G | G | C | A | G | A | U | C | U | G | ||||
| 2 | A | G | C | C | U | G | G | G | A | G | ||||
| 3 | C | U | C | U | C | U | G | C | C |
sample_1: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.7 mM; RNA (29-MER) 1.2 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM
sample_2: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.7 mM; RNA (29-MER) 1.2 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM
sample_3: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.5 mM; RNA (29-MER), [U-99% 13C; U-99% 15N], 1.0 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM
sample_4: DAB-VAL-ARG-THR-ARG-LYS-GLY-ARG-ARG-ILE-NOR-ILE-DPR-PRO 1.5 mM; RNA (29-MER), [U-99% 13C; U-99% 15N], 1.0 mM; EDTA 0.01 mM; potassium phosphate 20 mM; sodium chloride 10 mM
sample_conditions_1: ionic strength: 30 mM; pH: 6.5; pressure: 1 atm; temperature: 277 K
sample_conditions_2: ionic strength: 30 mM; pH: 6.5; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_2 |
| 3D 1H-15N NOESY | sample_3 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | sample_4 | isotropic | sample_conditions_2 |
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
SPARKY, Goddard - chemical shift assignment, peak picking