Click here to enlarge.
PDB ID: 2lhp
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17860
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ziegeler, Melanie; Cevec, Mirko; Richter, Christian; Schwalbe, Harald. "NMR Studies of HAR1 RNA Secondary Structures Reveal Conformational Dynamics in the Human RNA" Chembiochem 13, 2100-2112 (2012).
PubMed: 22961937
Assembly members:
RNA_(37-MER), polymer, 37 residues, 11872.162 Da.
Natural source: Common Name: chimpanzee Taxonomy ID: 9598 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Pan troglodytes
Experimental source: Production method: chemical synthesis Host organism: Escherichia coli Vector: pUC19
Entity Sequences (FASTA):
RNA_(37-MER): GGGUGAAAUGGAGGACUUCG
GUCCUCAAAUUUCACCC
Data type | Count |
1H chemical shifts | 282 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (37-MER) | 1 |
Entity 1, RNA (37-MER) 37 residues - 11872.162 Da.
1 | G | G | G | U | G | A | A | A | U | G | ||||
2 | G | A | G | G | A | C | U | U | C | G | ||||
3 | G | U | C | C | U | C | A | A | A | U | ||||
4 | U | U | C | A | C | C | C |