Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53223
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Kim, Iktae; Bang, Kyeong-Mi; An, So Young; Park, Changkon; Shin, Ji-Yeon; Kim, Youngim; Song, Hyun Kyu; Suh, Jeong-Yong; Kim, Nak-Kyoon. "Structural investigation of human U6 snRNA recognition by spliceosomal recycling factor SART3 RNA recognition motifs" FEBS J. 293, 1323-1340 (2026).
PubMed: 41046346
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGAACGAUACAGAGAAGAUU
AG
| Data type | Count |
| 13C chemical shifts | 22 |
| 1H chemical shifts | 51 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Asymmetric bulge of human U6 snRNA | 1 |
Entity 1, Asymmetric bulge of human U6 snRNA 22 residues - Formula weight is not available
| 1 | G | G | A | A | C | G | A | U | A | C | ||||
| 2 | A | G | A | G | A | A | G | A | U | U | ||||
| 3 | A | G |
sample_1: Asymmetric bulge of human U6 snRNA 900 uM; Sodium phosphate 20 mM; Sodium chloride 100 mM
sample_2: Asymmetric bulge of human U6 snRNA, [U-100% 13C; U-100% 15N], 100 uM; Sodium phosphate 20 mM; Sodium chloride 100 mM
sample_conditions_1: ionic strength: 120 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
NMRFAM-SPARKY - chemical shift assignment, data analysis, peak picking
TOPSPIN - processing