data_53223 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53223 _Entry.Title ; Nucleobase and ribose protons of asymmeric bulge of human U6 snRNA ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2025-06-11 _Entry.Accession_date 2025-06-11 _Entry.Last_release_date 2025-06-12 _Entry.Original_release_date 2025-06-12 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Iktae Kim . . . . 53223 2 Kyeong-Mi Bang . . . . 53223 3 'So Young' An . . . . 53223 4 Changkon Park . . . . 53223 5 Ji-Yeon Shin . . . . 53223 6 Youngim Kim . . . . 53223 7 'Hyun Kyu' Song . . . . 53223 8 Jeong-Yong Suh . . . . 53223 9 Nak-Kyoon Kim . . . . 53223 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 53223 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 22 53223 '1H chemical shifts' 51 53223 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2025-11-11 . original BMRB . 53223 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53223 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 41046346 _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Structural investigation of human U6 snRNA recognition by spliceosomal recycling factor SART3 RNA recognition motifs ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'FEBS J.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year 2025 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Iktae Kim . . . . 53223 1 2 Kyeong-Mi Bang . . . . 53223 1 3 'So Young' An . . . . 53223 1 4 Changkon Park . . . . 53223 1 5 Ji-Yeon Shin . . . . 53223 1 6 Youngim Kim . . . . 53223 1 7 'Hyun Kyu' Song . . . . 53223 1 8 Jeong-Yong Suh . . . . 53223 1 9 Nak-Kyoon Kim . . . . 53223 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53223 _Assembly.ID 1 _Assembly.Name 'Asymmetric bulge of human U6 snRNA' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'Asymmetric bulge of human U6 snRNA' 1 $entity_1 . . yes native no no . . . 53223 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53223 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAACGAUACAGAGAAGAUU AG ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 33 G . 53223 1 2 34 G . 53223 1 3 35 A . 53223 1 4 36 A . 53223 1 5 37 C . 53223 1 6 38 G . 53223 1 7 39 A . 53223 1 8 40 U . 53223 1 9 41 A . 53223 1 10 42 C . 53223 1 11 43 A . 53223 1 12 44 G . 53223 1 13 45 A . 53223 1 14 46 G . 53223 1 15 47 A . 53223 1 16 48 A . 53223 1 17 49 G . 53223 1 18 50 A . 53223 1 19 51 U . 53223 1 20 52 U . 53223 1 21 53 A . 53223 1 22 54 G . 53223 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 53223 1 . G 2 2 53223 1 . A 3 3 53223 1 . A 4 4 53223 1 . C 5 5 53223 1 . G 6 6 53223 1 . A 7 7 53223 1 . U 8 8 53223 1 . A 9 9 53223 1 . C 10 10 53223 1 . A 11 11 53223 1 . G 12 12 53223 1 . A 13 13 53223 1 . G 14 14 53223 1 . A 15 15 53223 1 . A 16 16 53223 1 . G 17 17 53223 1 . A 18 18 53223 1 . U 19 19 53223 1 . U 20 20 53223 1 . A 21 21 53223 1 . G 22 22 53223 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53223 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 53223 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53223 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . . 53223 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 53223 _Sample.ID 1 _Sample.Name 'Asymmetric bulge of human U6 snRNA_Non' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Asymmetric bulge of human U6 snRNA' 'natural abundance' . . 1 $entity_1 . . 900 . . uM . . . . 53223 1 2 'Sodium phosphate' 'natural abundance' . . . . . . 20 . . mM . . . . 53223 1 3 'Sodium chloride' 'natural abundance' . . . . . . 100 . . mM . . . . 53223 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 53223 _Sample.ID 2 _Sample.Name 'Asymmetric bulge of human U6 snRNA_FL' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '100% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'Asymmetric bulge of human U6 snRNA' '[U-100% 13C; U-100% 15N]' . . 1 $entity_1 . . 100 . . uM . . . . 53223 2 2 'Sodium phosphate' 'natural abundance' . . . . . . 20 . . mM . . . . 53223 2 3 'Sodium chloride' 'natural abundance' . . . . . . 100 . . mM . . . . 53223 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53223 _Sample_condition_list.ID 1 _Sample_condition_list.Name 'Asymmetric bulge of human U6 snRNA' _Sample_condition_list.Details ; 20 mM Sodium phosphate pH 6.5 100 mM Sodium chloride ; loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 120 . mM 53223 1 pH 6.5 . pH 53223 1 pressure 1 . atm 53223 1 temperature 298 . K 53223 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53223 _Software.ID 1 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 53223 1 'data analysis' . 53223 1 'peak picking' . 53223 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 53223 _Software.ID 2 _Software.Type . _Software.Name TOPSPIN _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 53223 2 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53223 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker Avance-III HD 800 MHz NMR spectrometers' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 800 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53223 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53223 1 2 '2D 1H-13C HSQC' no . . . . . . . . . . . . 2 $sample_2 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53223 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 53223 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name DSS _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.251449530 . . . . . 53223 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . 53223 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 53223 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name 2D_NOESY_U6_33-54_20mM_NaPi_pH65_100mM_NaCl_100pD2O_25C_20240419.list _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' . . . 53223 1 2 '2D 1H-13C HSQC' . . . 53223 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53223 1 2 $software_2 . . 53223 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.611 0.000 . 1 . . . . . 33 G H1' . 53223 1 2 . 1 . 1 1 1 G H8 H 1 7.927 0.002 . 1 . . . . . 33 G H8 . 53223 1 3 . 1 . 1 1 1 G C8 C 13 137.624 0.000 . 1 . . . . . 33 G C8 . 53223 1 4 . 1 . 1 2 2 G H1' H 1 5.646 0.000 . 1 . . . . . 34 G H1' . 53223 1 5 . 1 . 1 2 2 G H8 H 1 7.806 0.002 . 1 . . . . . 34 G H8 . 53223 1 6 . 1 . 1 2 2 G C8 C 13 137.661 0.000 . 1 . . . . . 34 G C8 . 53223 1 7 . 1 . 1 3 3 A H1' H 1 5.808 0.000 . 1 . . . . . 35 A H1' . 53223 1 8 . 1 . 1 3 3 A H8 H 1 8.120 0.001 . 1 . . . . . 35 A H8 . 53223 1 9 . 1 . 1 3 3 A C8 C 13 139.485 0.000 . 1 . . . . . 35 A C8 . 53223 1 10 . 1 . 1 4 4 A H1' H 1 5.713 0.000 . 1 . . . . . 36 A H1' . 53223 1 11 . 1 . 1 4 4 A H8 H 1 8.004 0.002 . 1 . . . . . 36 A H8 . 53223 1 12 . 1 . 1 4 4 A C8 C 13 138.443 0.000 . 1 . . . . . 36 A C8 . 53223 1 13 . 1 . 1 5 5 C H1' H 1 5.590 0.000 . 1 . . . . . 37 C H1' . 53223 1 14 . 1 . 1 5 5 C H5 H 1 5.448 0.001 . 1 . . . . . 37 C H5 . 53223 1 15 . 1 . 1 5 5 C H6 H 1 7.425 0.005 . 1 . . . . . 37 C H6 . 53223 1 16 . 1 . 1 5 5 C C6 C 13 139.379 0.000 . 1 . . . . . 37 C C6 . 53223 1 17 . 1 . 1 6 6 G H1' H 1 5.545 0.000 . 1 . . . . . 38 G H1' . 53223 1 18 . 1 . 1 6 6 G H8 H 1 7.694 0.003 . 1 . . . . . 38 G H8 . 53223 1 19 . 1 . 1 6 6 G C8 C 13 137.286 0.000 . 1 . . . . . 38 G C8 . 53223 1 20 . 1 . 1 7 7 A H1' H 1 5.770 0.001 . 1 . . . . . 39 A H1' . 53223 1 21 . 1 . 1 7 7 A H8 H 1 8.025 0.001 . 1 . . . . . 39 A H8 . 53223 1 22 . 1 . 1 7 7 A C8 C 13 139.115 0.000 . 1 . . . . . 39 A C8 . 53223 1 23 . 1 . 1 8 8 U H1' H 1 5.633 0.001 . 1 . . . . . 40 U H1' . 53223 1 24 . 1 . 1 8 8 U H5 H 1 5.478 0.002 . 1 . . . . . 40 U H5 . 53223 1 25 . 1 . 1 8 8 U H6 H 1 7.572 0.002 . 1 . . . . . 40 U H6 . 53223 1 26 . 1 . 1 8 8 U C6 C 13 140.644 0.000 . 1 . . . . . 40 U C6 . 53223 1 27 . 1 . 1 9 9 A H1' H 1 5.818 0.000 . 1 . . . . . 41 A H1' . 53223 1 28 . 1 . 1 9 9 A H8 H 1 8.127 0.001 . 1 . . . . . 41 A H8 . 53223 1 29 . 1 . 1 9 9 A C8 C 13 139.044 0.000 . 1 . . . . . 41 A C8 . 53223 1 30 . 1 . 1 10 10 C H1' H 1 5.672 0.174 . 1 . . . . . 42 C H1' . 53223 1 31 . 1 . 1 10 10 C H5 H 1 5.454 0.004 . 1 . . . . . 42 C H5 . 53223 1 32 . 1 . 1 10 10 C H6 H 1 7.441 0.002 . 1 . . . . . 42 C H6 . 53223 1 33 . 1 . 1 10 10 C C6 C 13 139.589 0.000 . 1 . . . . . 42 C C6 . 53223 1 34 . 1 . 1 11 11 A H1' H 1 5.749 0.000 . 1 . . . . . 43 A H1' . 53223 1 35 . 1 . 1 11 11 A H8 H 1 8.035 0.001 . 1 . . . . . 43 A H8 . 53223 1 36 . 1 . 1 11 11 A C8 C 13 138.866 0.000 . 1 . . . . . 43 A C8 . 53223 1 37 . 1 . 1 12 12 G H1' H 1 5.449 0.001 . 1 . . . . . 44 G H1' . 53223 1 38 . 1 . 1 12 12 G H8 H 1 7.636 0.001 . 1 . . . . . 44 G H8 . 53223 1 39 . 1 . 1 12 12 G C8 C 13 136.891 0.000 . 1 . . . . . 44 G C8 . 53223 1 40 . 1 . 1 13 13 A H1' H 1 5.743 0.001 . 1 . . . . . 45 A H1' . 53223 1 41 . 1 . 1 13 13 A H2 H 1 7.844 0.000 . 1 . . . . . 45 A H2 . 53223 1 42 . 1 . 1 13 13 A H8 H 1 8.012 0.001 . 1 . . . . . 45 A H8 . 53223 1 43 . 1 . 1 13 13 A C8 C 13 139.109 0.000 . 1 . . . . . 45 A C8 . 53223 1 44 . 1 . 1 14 14 G H1' H 1 5.449 0.000 . 1 . . . . . 46 G H1' . 53223 1 45 . 1 . 1 14 14 G H8 H 1 7.636 0.003 . 1 . . . . . 46 G H8 . 53223 1 46 . 1 . 1 14 14 G C8 C 13 137.052 0.000 . 1 . . . . . 46 G C8 . 53223 1 47 . 1 . 1 15 15 A H1' H 1 5.748 0.000 . 1 . . . . . 47 A H1' . 53223 1 48 . 1 . 1 15 15 A H8 H 1 8.036 0.004 . 1 . . . . . 47 A H8 . 53223 1 49 . 1 . 1 15 15 A C8 C 13 139.019 0.000 . 1 . . . . . 47 A C8 . 53223 1 50 . 1 . 1 16 16 A H1' H 1 5.723 0.000 . 1 . . . . . 48 A H1' . 53223 1 51 . 1 . 1 16 16 A H2 H 1 7.756 0.000 . 1 . . . . . 48 A H2 . 53223 1 52 . 1 . 1 16 16 A H8 H 1 8.088 0.004 . 1 . . . . . 48 A H8 . 53223 1 53 . 1 . 1 16 16 A C8 C 13 139.203 0.000 . 1 . . . . . 48 A C8 . 53223 1 54 . 1 . 1 17 17 G H1' H 1 5.446 0.001 . 1 . . . . . 49 G H1' . 53223 1 55 . 1 . 1 17 17 G H8 H 1 7.775 0.002 . 1 . . . . . 49 G H8 . 53223 1 56 . 1 . 1 17 17 G C8 C 13 136.891 0.000 . 1 . . . . . 49 G C8 . 53223 1 57 . 1 . 1 18 18 A H1' H 1 5.812 0.000 . 1 . . . . . 50 A H1' . 53223 1 58 . 1 . 1 18 18 A H8 H 1 8.004 0.007 . 1 . . . . . 50 A H8 . 53223 1 59 . 1 . 1 18 18 A C8 C 13 138.706 0.000 . 1 . . . . . 50 A C8 . 53223 1 60 . 1 . 1 19 19 U H1' H 1 5.647 0.000 . 1 . . . . . 51 U H1' . 53223 1 61 . 1 . 1 19 19 U H5 H 1 5.452 0.000 . 1 . . . . . 51 U H5 . 53223 1 62 . 1 . 1 19 19 U H6 H 1 7.550 0.003 . 1 . . . . . 51 U H6 . 53223 1 63 . 1 . 1 19 19 U C6 C 13 140.597 0.000 . 1 . . . . . 51 U C6 . 53223 1 64 . 1 . 1 20 20 U H1' H 1 5.640 0.000 . 1 . . . . . 52 U H1' . 53223 1 65 . 1 . 1 20 20 U H5 H 1 5.679 0.000 . 1 . . . . . 52 U H5 . 53223 1 66 . 1 . 1 20 20 U H6 H 1 7.630 0.008 . 1 . . . . . 52 U H6 . 53223 1 67 . 1 . 1 20 20 U C6 C 13 141.045 0.000 . 1 . . . . . 52 U C6 . 53223 1 68 . 1 . 1 21 21 A H1' H 1 5.838 0.000 . 1 . . . . . 53 A H1' . 53223 1 69 . 1 . 1 21 21 A H8 H 1 8.151 0.002 . 1 . . . . . 53 A H8 . 53223 1 70 . 1 . 1 21 21 A C8 C 13 139.528 0.000 . 1 . . . . . 53 A C8 . 53223 1 71 . 1 . 1 22 22 G H1' H 1 5.666 0.000 . 1 . . . . . 54 G H1' . 53223 1 72 . 1 . 1 22 22 G H8 H 1 7.779 0.001 . 1 . . . . . 54 G H8 . 53223 1 73 . 1 . 1 22 22 G C8 C 13 137.535 0.000 . 1 . . . . . 54 G C8 . 53223 1 stop_ save_