Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36746
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Negi, D.; Sannapureddi, R.; Sathyamoorthy, B.; Reddy Sannapureddi, R.; Mohanty, M.; Gautam, A.; Sathyamoorthy, B.. "Molecular Interactions of a Frustrated G-Rich Sequence: Atomistic Insights into Folding of DNA G-Quadruplexes
" .
Assembly members:
DNA (5'-D(*AP*AP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*AP*A)-3'), polymer, 22 residues, 6983.497 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
DNA (5'-D(*AP*AP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*AP*A)-3'): AAGGGTTGGGTTGGGTTGGG
AA
| Data type | Count |
| 13C chemical shifts | 75 |
| 15N chemical shifts | 12 |
| 1H chemical shifts | 133 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 22 residues - 6983.497 Da.
| 1 | DA | DA | DG | DG | DG | DT | DT | DG | DG | DG | ||||
| 2 | DT | DT | DG | DG | DG | DT | DT | DG | DG | DG | ||||
| 3 | DA | DA |
sample_1: DNA (5'-D(*AP*AP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*AP*A)-3') 1.5 ± 0.1 mM; sodium chloride 50 ± 0.1 mM; sodium phosphate 20 ± 0.1 mM; dss 50 ± 0.1 uM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 418 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 418 mM; pH: 7; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HMQC | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC F2 coupled | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC F2 coupled | sample_1 | isotropic | sample_conditions_2 |
TopSpin, Bruker Biospin - collection
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRFAM-SPARKY, Lee W, Tonelli M, Markley JL - chemical shift assignment
NMRFAM-SPARKY, Lee W, Tonelli M, Markley JL - peak picking
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - geometry optimization
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement