data_36746 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 36746 _Entry.Title ; Structure of AA(GGGTT)3GGGAA G-quadruplex in the presence of sodium ions ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2025-03-25 _Entry.Accession_date 2025-03-25 _Entry.Last_release_date 2026-03-09 _Entry.Original_release_date 2026-03-09 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.2.0.16 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 D. Negi D. . . . 36746 2 R. Sannapureddi R. K.R. . . 36746 3 B. Sathyamoorthy B. . . . 36746 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID DNA . 36746 'Frustrated sequence' . 36746 G-quadruplex . 36746 'hybrid (3+1)' . 36746 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 36746 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 75 36746 '15N chemical shifts' 12 36746 '1H chemical shifts' 133 36746 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-06-06 . original BMRB . 36746 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 36747 'Structure of AA(GGGTT)3AA G-quadruplex in the presence of potassium ions' 36746 PDB 9U83 'BMRB Entry Tracking System' 36746 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 36746 _Citation.ID 1 _Citation.Name . _Citation.Class 'reference citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 33179931 _Citation.DOI 10.1021/acs.jpclett.0c02969 _Citation.Full_citation . _Citation.Title ; Characterization of DNA G-quadruplex Topologies with NMR Chemical Shifts. ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Phys. Chem. Lett.' _Citation.Journal_name_full 'The journal of physical chemistry letters' _Citation.Journal_volume 11 _Citation.Journal_issue 23 _Citation.Journal_ASTM . _Citation.Journal_ISSN 1948-7185 _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 10016 _Citation.Page_last 10022 _Citation.Year 2020 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Rajesh 'Reddy Sannapureddi' R. . . . 36746 1 2 Manish Mohanty M. K. . . 36746 1 3 Anoop Gautam A. K. . . 36746 1 4 Bharathwaj Sathyamoorthy B. . . . 36746 1 stop_ save_ save_citation_2 _Citation.Sf_category citations _Citation.Sf_framecode citation_2 _Citation.Entry_ID 36746 _Citation.ID 2 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Molecular Interactions of a Frustrated G-Rich Sequence: Atomistic Insights into Folding of DNA G-Quadruplexes ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev . _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 D. Negi D. . . . 36746 2 2 R. Sannapureddi R. K.R. . . 36746 2 3 B. Sathyamoorthy B. . . . 36746 2 4 R. 'Reddy Sannapureddi' R. K. . . 36746 2 5 M. Mohanty M. K. . . 36746 2 6 A. Gautam A. K. . . 36746 2 7 B. Sathyamoorthy B. . . . 36746 2 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 36746 _Assembly.ID 1 _Assembly.Name 'AA(GGGTT)3GGGAA G-quadruplex in presence sodium ions' _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 6983.497 _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 36746 1 stop_ loop_ _Chem_comp_assembly.Assembly_chem_comp_ID _Chem_comp_assembly.Entity_assembly_ID _Chem_comp_assembly.Entity_ID _Chem_comp_assembly.Comp_index_ID _Chem_comp_assembly.Comp_ID _Chem_comp_assembly.Seq_ID _Chem_comp_assembly.Auth_entity_assembly_ID _Chem_comp_assembly.Auth_asym_ID _Chem_comp_assembly.Auth_seq_ID _Chem_comp_assembly.Auth_comp_ID _Chem_comp_assembly.Auth_variant_ID _Chem_comp_assembly.Sequence_linking _Chem_comp_assembly.Cis_residue _Chem_comp_assembly.NEF_index _Chem_comp_assembly.Entry_ID _Chem_comp_assembly.Assembly_ID . 1 1 1 DA 1 . A 1 DA . start . . 36746 1 . 1 1 10 DG 10 . A 10 DG . middle . . 36746 1 . 1 1 11 DT 11 . A 11 DT . middle . . 36746 1 . 1 1 12 DT 12 . A 12 DT . middle . . 36746 1 . 1 1 13 DG 13 . A 13 DG . middle . . 36746 1 . 1 1 14 DG 14 . A 14 DG . middle . . 36746 1 . 1 1 15 DG 15 . A 15 DG . middle . . 36746 1 . 1 1 16 DT 16 . A 16 DT . middle . . 36746 1 . 1 1 17 DT 17 . A 17 DT . middle . . 36746 1 . 1 1 18 DG 18 . A 18 DG . middle . . 36746 1 . 1 1 19 DG 19 . A 19 DG . middle . . 36746 1 . 1 1 2 DA 2 . A 2 DA . middle . . 36746 1 . 1 1 20 DG 20 . A 20 DG . middle . . 36746 1 . 1 1 21 DA 21 . A 21 DA . middle . . 36746 1 . 1 1 22 DA 22 . A 22 DA . end . . 36746 1 . 1 1 3 DG 3 . A 3 DG . middle . . 36746 1 . 1 1 4 DG 4 . A 4 DG . middle . . 36746 1 . 1 1 5 DG 5 . A 5 DG . middle . . 36746 1 . 1 1 6 DT 6 . A 6 DT . middle . . 36746 1 . 1 1 7 DT 7 . A 7 DT . middle . . 36746 1 . 1 1 8 DG 8 . A 8 DG . middle . . 36746 1 . 1 1 9 DG 9 . A 9 DG . middle . . 36746 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 36746 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name "DNA (5'-D(*AP*AP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*AP*A)-3')" _Entity.Type polymer _Entity.Polymer_common_type DNA _Entity.Polymer_type polydeoxyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; AAGGGTTGGGTTGGGTTGGG AA ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 22 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6983.497 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 DA . 36746 1 2 2 DA . 36746 1 3 3 DG . 36746 1 4 4 DG . 36746 1 5 5 DG . 36746 1 6 6 DT . 36746 1 7 7 DT . 36746 1 8 8 DG . 36746 1 9 9 DG . 36746 1 10 10 DG . 36746 1 11 11 DT . 36746 1 12 12 DT . 36746 1 13 13 DG . 36746 1 14 14 DG . 36746 1 15 15 DG . 36746 1 16 16 DT . 36746 1 17 17 DT . 36746 1 18 18 DG . 36746 1 19 19 DG . 36746 1 20 20 DG . 36746 1 21 21 DA . 36746 1 22 22 DA . 36746 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . DA 1 1 36746 1 . DA 2 2 36746 1 . DG 3 3 36746 1 . DG 4 4 36746 1 . DG 5 5 36746 1 . DT 6 6 36746 1 . DT 7 7 36746 1 . DG 8 8 36746 1 . DG 9 9 36746 1 . DG 10 10 36746 1 . DT 11 11 36746 1 . DT 12 12 36746 1 . DG 13 13 36746 1 . DG 14 14 36746 1 . DG 15 15 36746 1 . DT 16 16 36746 1 . DT 17 17 36746 1 . DG 18 18 36746 1 . DG 19 19 36746 1 . DG 20 20 36746 1 . DA 21 21 36746 1 . DA 22 22 36746 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 36746 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 32630 'no natural source' . 'synthetic construct' . . . . . . . . . . . . . . . . . . . . 36746 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 36746 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' unidentified . . . . . . . . . . . . . . . 36746 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 36746 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details ; 1.5 mM DNA (5'-D(*AP*AP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*AP*A)-3'), 20 mM sodium phosphate, 50 mM sodium chloride, 50 uM dss, 95% H2O/5% D2O ; _Sample.Aggregate_sample_number . _Sample.Solvent_system '95% H2O/5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 "DNA (5'-D(*AP*AP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*GP*GP*GP*AP*A)-3')" 'natural abundance' 1 $assembly 1 $entity_1 . DNA 1.5 . . mM 0.1 . . . 36746 1 2 'sodium chloride' 'natural abundance' . . . . . salt 50 . . mM 0.1 . . . 36746 1 3 'sodium phosphate' 'natural abundance' . . . . . buffer 20 . . mM 0.1 . . . 36746 1 4 dss 'natural abundance' . . . . . 'internal reference' 50 . . uM 0.1 . . . 36746 1 5 H2O 'natural abundance' . . . . . solvent 95 . . % . . . . 36746 1 6 D2O [U-2H] . . . . . solvent 5 . . % . . . . 36746 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 36746 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 418 . mM 36746 1 pH 7 0.1 pH 36746 1 pressure 1 0.02 atm 36746 1 temperature 298 0.1 K 36746 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 36746 _Sample_condition_list.ID 2 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 418 . mM 36746 2 pH 7 0.1 pH 36746 2 pressure 1 0.02 atm 36746 2 temperature 298 0.1 K 36746 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 36746 _Software.ID 1 _Software.Type . _Software.Name TopSpin _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Bruker Biospin' . . 36746 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID collection . 36746 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 36746 _Software.ID 2 _Software.Type . _Software.Name NMRPipe _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax' . . 36746 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID processing . 36746 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 36746 _Software.ID 3 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details ; Bioinformatics. 2015 Apr 15; 31(8):1325-7. Epub 2014 Dec 12 NMRFAM-SPARKY: enhanced software for biomolecular NMR spectroscopy. ; loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee W, Tonelli M, Markley JL' . . 36746 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 36746 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 36746 _Software.ID 4 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details ; Bioinformatics. 2015 Apr 15; 31(8):1325-7. Epub 2014 Dec 12 NMRFAM-SPARKY: enhanced software for biomolecular NMR spectroscopy. ; loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Lee W, Tonelli M, Markley JL' . . 36746 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'peak picking' . 36746 4 stop_ save_ save_software_5 _Software.Sf_category software _Software.Sf_framecode software_5 _Software.Entry_ID 36746 _Software.ID 5 _Software.Type . _Software.Name 'X-PLOR NIH' _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Schwieters, Kuszewski, Tjandra and Clore' . . 36746 5 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'geometry optimization' . 36746 5 stop_ save_ save_software_6 _Software.Sf_category software _Software.Sf_framecode software_6 _Software.Entry_ID 36746 _Software.ID 6 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 36746 6 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 36746 6 stop_ save_ save_software_7 _Software.Sf_category software _Software.Sf_framecode software_7 _Software.Entry_ID 36746 _Software.ID 7 _Software.Type . _Software.Name Amber _Software.Version . _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman' . . 36746 7 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 36746 7 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 36746 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE III' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ save_NMR_spectrometer_list_1 _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list_1 _NMR_spectrometer_list.Entry_ID 36746 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker 'AVANCE III' . 700 . . . 36746 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 36746 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36746 1 2 '2D 1H-13C HSQC' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36746 1 3 '2D 1H-15N HMQC' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36746 1 4 '2D DQF-COSY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36746 1 5 '2D 1H-13C HSQC F2 coupled' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36746 1 6 '2D 1H-13C HSQC F2 coupled' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36746 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 36746 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl carbons' . . . . ppm 0 internal direct 0.25144953 . . . . . 36746 1 H 1 DSS 'methyl protons' . . . . ppm 0 internal direct 1.0 . . . . . 36746 1 N 15 DSS 'methyl protons' . . . . ppm 0 internal indirect 0.100 . . . . . 36746 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 36746 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err 0.02 _Assigned_chem_shift_list.Chem_shift_13C_err 0.1 _Assigned_chem_shift_list.Chem_shift_15N_err 0.1 _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D 1H-1H NOESY' 1 $sample_1 isotropic 36746 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 36746 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 DA H1' H 1 5.556 0.002 . 1 . . . . A 1 DA H1' . 36746 1 2 . 1 . 1 1 1 DA H2 H 1 7.594 0.002 . 1 . . . . A 1 DA H2 . 36746 1 3 . 1 . 1 1 1 DA H2' H 1 2.037 0.002 . 1 . . . . A 1 DA H2' . 36746 1 4 . 1 . 1 1 1 DA H2'' H 1 2.065 0.002 . 1 . . . . A 1 DA H2'' . 36746 1 5 . 1 . 1 1 1 DA H3' H 1 4.397 0.002 . 1 . . . . A 1 DA H3' . 36746 1 6 . 1 . 1 1 1 DA H4' H 1 3.792 0.002 . 1 . . . . A 1 DA H4' . 36746 1 7 . 1 . 1 1 1 DA H8 H 1 7.442 0.002 . 1 . . . . A 1 DA H8 . 36746 1 8 . 1 . 1 1 1 DA C1' C 13 87.11 0.01 . 1 . . . . A 1 DA C1' . 36746 1 9 . 1 . 1 1 1 DA C2 C 13 154.5 0.01 . 1 . . . . A 1 DA C2 . 36746 1 10 . 1 . 1 1 1 DA C2' C 13 39.87 0.01 . 1 . . . . A 1 DA C2' . 36746 1 11 . 1 . 1 1 1 DA C3' C 13 78.1 0.01 . 1 . . . . A 1 DA C3' . 36746 1 12 . 1 . 1 1 1 DA C4' C 13 88.52 0.01 . 1 . . . . A 1 DA C4' . 36746 1 13 . 1 . 1 1 1 DA C8 C 13 142.4 0.01 . 1 . . . . A 1 DA C8 . 36746 1 14 . 1 . 1 2 2 DA H1' H 1 5.857 0.002 . 1 . . . . A 2 DA H1' . 36746 1 15 . 1 . 1 2 2 DA H2 H 1 7.358 0.002 . 1 . . . . A 2 DA H2 . 36746 1 16 . 1 . 1 2 2 DA H2' H 1 1.86 0.002 . 1 . . . . A 2 DA H2' . 36746 1 17 . 1 . 1 2 2 DA H2'' H 1 2.59 0.002 . 1 . . . . A 2 DA H2'' . 36746 1 18 . 1 . 1 2 2 DA H8 H 1 7.932 0.002 . 1 . . . . A 2 DA H8 . 36746 1 19 . 1 . 1 2 2 DA C1' C 13 88.84 0.01 . 1 . . . . A 2 DA C1' . 36746 1 20 . 1 . 1 2 2 DA C2 C 13 154.6 0.01 . 1 . . . . A 2 DA C2 . 36746 1 21 . 1 . 1 2 2 DA C2' C 13 44 0.01 . 1 . . . . A 2 DA C2' . 36746 1 22 . 1 . 1 2 2 DA C8 C 13 140.5 0.01 . 1 . . . . A 2 DA C8 . 36746 1 23 . 1 . 1 3 3 DG H1 H 1 10.9 0.002 . 1 . . . . A 3 DG H1 . 36746 1 24 . 1 . 1 3 3 DG H1' H 1 5.985 0.002 . 1 . . . . A 3 DG H1' . 36746 1 25 . 1 . 1 3 3 DG H2' H 1 2.721 0.002 . 1 . . . . A 3 DG H2' . 36746 1 26 . 1 . 1 3 3 DG H2'' H 1 3.34 0.002 . 1 . . . . A 3 DG H2'' . 36746 1 27 . 1 . 1 3 3 DG H21 H 1 6.927 0.002 . 1 . . . . A 3 DG H21 . 36746 1 28 . 1 . 1 3 3 DG H22 H 1 10.04 0.002 . 1 . . . . A 3 DG H22 . 36746 1 29 . 1 . 1 3 3 DG H8 H 1 7.574 0.002 . 1 . . . . A 3 DG H8 . 36746 1 30 . 1 . 1 3 3 DG C1' C 13 89.96 0.01 . 1 . . . . A 3 DG C1' . 36746 1 31 . 1 . 1 3 3 DG C2' C 13 35.03 0.01 . 1 . . . . A 3 DG C2' . 36746 1 32 . 1 . 1 3 3 DG C8 C 13 142.1 0.01 . 1 . . . . A 3 DG C8 . 36746 1 33 . 1 . 1 3 3 DG N1 N 15 143.7 0.01 . 1 . . . . A 3 DG N1 . 36746 1 34 . 1 . 1 4 4 DG H1 H 1 11.57 0.002 . 1 . . . . A 4 DG H1 . 36746 1 35 . 1 . 1 4 4 DG H1' H 1 6.086 0.002 . 1 . . . . A 4 DG H1' . 36746 1 36 . 1 . 1 4 4 DG H2' H 1 2.451 0.002 . 1 . . . . A 4 DG H2' . 36746 1 37 . 1 . 1 4 4 DG H2'' H 1 2.824 0.002 . 1 . . . . A 4 DG H2'' . 36746 1 38 . 1 . 1 4 4 DG H3' H 1 5.061 0.002 . 1 . . . . A 4 DG H3' . 36746 1 39 . 1 . 1 4 4 DG H8 H 1 7.963 0.002 . 1 . . . . A 4 DG H8 . 36746 1 40 . 1 . 1 4 4 DG C1' C 13 83.63 0.01 . 1 . . . . A 4 DG C1' . 36746 1 41 . 1 . 1 4 4 DG C2' C 13 39.07 0.01 . 1 . . . . A 4 DG C2' . 36746 1 42 . 1 . 1 4 4 DG C8 C 13 139.3 0.01 . 1 . . . . A 4 DG C8 . 36746 1 43 . 1 . 1 4 4 DG N1 N 15 144.7 0.01 . 1 . . . . A 4 DG N1 . 36746 1 44 . 1 . 1 5 5 DG H1 H 1 10.41 0.002 . 1 . . . . A 5 DG H1 . 36746 1 45 . 1 . 1 5 5 DG H1' H 1 5.869 0.002 . 1 . . . . A 5 DG H1' . 36746 1 46 . 1 . 1 5 5 DG H2' H 1 2.536 0.002 . 1 . . . . A 5 DG H2' . 36746 1 47 . 1 . 1 5 5 DG H2'' H 1 2.697 0.002 . 1 . . . . A 5 DG H2'' . 36746 1 48 . 1 . 1 5 5 DG H3' H 1 4.911 0.002 . 1 . . . . A 5 DG H3' . 36746 1 49 . 1 . 1 5 5 DG H8 H 1 7.76 0.002 . 1 . . . . A 5 DG H8 . 36746 1 50 . 1 . 1 5 5 DG C1' C 13 84 0.01 . 1 . . . . A 5 DG C1' . 36746 1 51 . 1 . 1 5 5 DG C8 C 13 138.3 0.01 . 1 . . . . A 5 DG C8 . 36746 1 52 . 1 . 1 5 5 DG N1 N 15 142.3 0.01 . 1 . . . . A 5 DG N1 . 36746 1 53 . 1 . 1 6 6 DT H1' H 1 5.388 0.002 . 1 . . . . A 6 DT H1' . 36746 1 54 . 1 . 1 6 6 DT H2' H 1 1.897 0.002 . 1 . . . . A 6 DT H2' . 36746 1 55 . 1 . 1 6 6 DT H6 H 1 7.777 0.002 . 1 . . . . A 6 DT H6 . 36746 1 56 . 1 . 1 6 6 DT H71 H 1 1.921 0.002 . 1 . . . . A 6 DT H71 . 36746 1 57 . 1 . 1 6 6 DT H72 H 1 1.921 0.002 . 1 . . . . A 6 DT H72 . 36746 1 58 . 1 . 1 6 6 DT H73 H 1 1.921 0.002 . 1 . . . . A 6 DT H73 . 36746 1 59 . 1 . 1 6 6 DT C1' C 13 84.92 0.01 . 1 . . . . A 6 DT C1' . 36746 1 60 . 1 . 1 6 6 DT C6 C 13 139.1 0.01 . 1 . . . . A 6 DT C6 . 36746 1 61 . 1 . 1 6 6 DT C7 C 13 14.45 0.01 . 1 . . . . A 6 DT C7 . 36746 1 62 . 1 . 1 7 7 DT H1' H 1 5.751 0.002 . 1 . . . . A 7 DT H1' . 36746 1 63 . 1 . 1 7 7 DT H2' H 1 1.905 0.002 . 1 . . . . A 7 DT H2' . 36746 1 64 . 1 . 1 7 7 DT H2'' H 1 2.146 0.002 . 1 . . . . A 7 DT H2'' . 36746 1 65 . 1 . 1 7 7 DT H6 H 1 7.178 0.002 . 1 . . . . A 7 DT H6 . 36746 1 66 . 1 . 1 7 7 DT H71 H 1 1.327 0.002 . 1 . . . . A 7 DT H71 . 36746 1 67 . 1 . 1 7 7 DT H72 H 1 1.327 0.002 . 1 . . . . A 7 DT H72 . 36746 1 68 . 1 . 1 7 7 DT H73 H 1 1.327 0.002 . 1 . . . . A 7 DT H73 . 36746 1 69 . 1 . 1 7 7 DT C1' C 13 85.22 0.01 . 1 . . . . A 7 DT C1' . 36746 1 70 . 1 . 1 7 7 DT C2' C 13 40.98 0.01 . 1 . . . . A 7 DT C2' . 36746 1 71 . 1 . 1 7 7 DT C6 C 13 138.5 0.01 . 1 . . . . A 7 DT C6 . 36746 1 72 . 1 . 1 7 7 DT C7 C 13 14.24 0.01 . 1 . . . . A 7 DT C7 . 36746 1 73 . 1 . 1 8 8 DG H1 H 1 11.86 0.002 . 1 . . . . A 8 DG H1 . 36746 1 74 . 1 . 1 8 8 DG H1' H 1 6.046 0.002 . 1 . . . . A 8 DG H1' . 36746 1 75 . 1 . 1 8 8 DG H2' H 1 2.987 0.002 . 1 . . . . A 8 DG H2' . 36746 1 76 . 1 . 1 8 8 DG H2'' H 1 3.461 0.002 . 1 . . . . A 8 DG H2'' . 36746 1 77 . 1 . 1 8 8 DG H8 H 1 7.093 0.002 . 1 . . . . A 8 DG H8 . 36746 1 78 . 1 . 1 8 8 DG C1' C 13 89.03 0.01 . 1 . . . . A 8 DG C1' . 36746 1 79 . 1 . 1 8 8 DG C2' C 13 35.92 0.01 . 1 . . . . A 8 DG C2' . 36746 1 80 . 1 . 1 8 8 DG C8 C 13 142.5 0.01 . 1 . . . . A 8 DG C8 . 36746 1 81 . 1 . 1 8 8 DG N1 N 15 145.8 0.01 . 1 . . . . A 8 DG N1 . 36746 1 82 . 1 . 1 9 9 DG H1 H 1 10.83 0.002 . 1 . . . . A 9 DG H1 . 36746 1 83 . 1 . 1 9 9 DG H1' H 1 5.959 0.002 . 1 . . . . A 9 DG H1' . 36746 1 84 . 1 . 1 9 9 DG H2' H 1 2.54 0.002 . 1 . . . . A 9 DG H2' . 36746 1 85 . 1 . 1 9 9 DG H2'' H 1 2.864 0.002 . 1 . . . . A 9 DG H2'' . 36746 1 86 . 1 . 1 9 9 DG H21 H 1 6.901 0.002 . 1 . . . . A 9 DG H21 . 36746 1 87 . 1 . 1 9 9 DG H8 H 1 7.654 0.002 . 1 . . . . A 9 DG H8 . 36746 1 88 . 1 . 1 9 9 DG C1' C 13 89.09 0.01 . 1 . . . . A 9 DG C1' . 36746 1 89 . 1 . 1 9 9 DG C2' C 13 37.24 0.01 . 1 . . . . A 9 DG C2' . 36746 1 90 . 1 . 1 9 9 DG C8 C 13 141.6 0.01 . 1 . . . . A 9 DG C8 . 36746 1 91 . 1 . 1 9 9 DG N1 N 15 143.3 0.01 . 1 . . . . A 9 DG N1 . 36746 1 92 . 1 . 1 10 10 DG H1 H 1 11.74 0.002 . 1 . . . . A 10 DG H1 . 36746 1 93 . 1 . 1 10 10 DG H1' H 1 6.091 0.002 . 1 . . . . A 10 DG H1' . 36746 1 94 . 1 . 1 10 10 DG H2' H 1 2.503 0.002 . 1 . . . . A 10 DG H2' . 36746 1 95 . 1 . 1 10 10 DG H2'' H 1 3.108 0.002 . 1 . . . . A 10 DG H2'' . 36746 1 96 . 1 . 1 10 10 DG H3' H 1 5.168 0.002 . 1 . . . . A 10 DG H3' . 36746 1 97 . 1 . 1 10 10 DG H8 H 1 8.409 0.002 . 1 . . . . A 10 DG H8 . 36746 1 98 . 1 . 1 10 10 DG C1' C 13 83.54 0.01 . 1 . . . . A 10 DG C1' . 36746 1 99 . 1 . 1 10 10 DG C2' C 13 41.56 0.01 . 1 . . . . A 10 DG C2' . 36746 1 100 . 1 . 1 10 10 DG C8 C 13 138.9 0.01 . 1 . . . . A 10 DG C8 . 36746 1 101 . 1 . 1 10 10 DG N1 N 15 144.7 0.01 . 1 . . . . A 10 DG N1 . 36746 1 102 . 1 . 1 11 11 DT H1' H 1 6.222 0.002 . 1 . . . . A 11 DT H1' . 36746 1 103 . 1 . 1 11 11 DT H2' H 1 2.178 0.002 . 1 . . . . A 11 DT H2' . 36746 1 104 . 1 . 1 11 11 DT H2'' H 1 2.541 0.002 . 1 . . . . A 11 DT H2'' . 36746 1 105 . 1 . 1 11 11 DT H6 H 1 7.745 0.002 . 1 . . . . A 11 DT H6 . 36746 1 106 . 1 . 1 11 11 DT H71 H 1 1.943 0.002 . 1 . . . . A 11 DT H71 . 36746 1 107 . 1 . 1 11 11 DT H72 H 1 1.943 0.002 . 1 . . . . A 11 DT H72 . 36746 1 108 . 1 . 1 11 11 DT H73 H 1 1.943 0.002 . 1 . . . . A 11 DT H73 . 36746 1 109 . 1 . 1 11 11 DT C1' C 13 87.53 0.01 . 1 . . . . A 11 DT C1' . 36746 1 110 . 1 . 1 11 11 DT C2' C 13 41 0.01 . 1 . . . . A 11 DT C2' . 36746 1 111 . 1 . 1 11 11 DT C6 C 13 139.3 0.01 . 1 . . . . A 11 DT C6 . 36746 1 112 . 1 . 1 11 11 DT C7 C 13 14.54 0.01 . 1 . . . . A 11 DT C7 . 36746 1 113 . 1 . 1 12 12 DT H1' H 1 5.843 0.002 . 1 . . . . A 12 DT H1' . 36746 1 114 . 1 . 1 12 12 DT H2' H 1 2.084 0.002 . 1 . . . . A 12 DT H2' . 36746 1 115 . 1 . 1 12 12 DT H2'' H 1 2.667 0.002 . 1 . . . . A 12 DT H2'' . 36746 1 116 . 1 . 1 12 12 DT H3 H 1 12.56 0.002 . 1 . . . . A 12 DT H3 . 36746 1 117 . 1 . 1 12 12 DT H6 H 1 7.125 0.002 . 1 . . . . A 12 DT H6 . 36746 1 118 . 1 . 1 12 12 DT H71 H 1 0.902 0.002 . 1 . . . . A 12 DT H71 . 36746 1 119 . 1 . 1 12 12 DT H72 H 1 0.902 0.002 . 1 . . . . A 12 DT H72 . 36746 1 120 . 1 . 1 12 12 DT H73 H 1 0.902 0.002 . 1 . . . . A 12 DT H73 . 36746 1 121 . 1 . 1 12 12 DT C1' C 13 86.88 0.01 . 1 . . . . A 12 DT C1' . 36746 1 122 . 1 . 1 12 12 DT C2' C 13 41.26 0.01 . 1 . . . . A 12 DT C2' . 36746 1 123 . 1 . 1 12 12 DT C6 C 13 137.9 0.01 . 1 . . . . A 12 DT C6 . 36746 1 124 . 1 . 1 12 12 DT C7 C 13 13.89 0.01 . 1 . . . . A 12 DT C7 . 36746 1 125 . 1 . 1 13 13 DG H1 H 1 11.13 0.002 . 1 . . . . A 13 DG H1 . 36746 1 126 . 1 . 1 13 13 DG H1' H 1 6.28 0.002 . 1 . . . . A 13 DG H1' . 36746 1 127 . 1 . 1 13 13 DG H2' H 1 3.093 0.002 . 1 . . . . A 13 DG H2' . 36746 1 128 . 1 . 1 13 13 DG H2'' H 1 3.663 0.002 . 1 . . . . A 13 DG H2'' . 36746 1 129 . 1 . 1 13 13 DG H21 H 1 9.521 0.002 . 1 . . . . A 13 DG H21 . 36746 1 130 . 1 . 1 13 13 DG H8 H 1 7.632 0.002 . 1 . . . . A 13 DG H8 . 36746 1 131 . 1 . 1 13 13 DG C1' C 13 89.28 0.01 . 1 . . . . A 13 DG C1' . 36746 1 132 . 1 . 1 13 13 DG C2' C 13 35.46 0.01 . 1 . . . . A 13 DG C2' . 36746 1 133 . 1 . 1 13 13 DG C8 C 13 142.3 0.01 . 1 . . . . A 13 DG C8 . 36746 1 134 . 1 . 1 13 13 DG N1 N 15 143.2 0.01 . 1 . . . . A 13 DG N1 . 36746 1 135 . 1 . 1 14 14 DG H1 H 1 10.86 0.002 . 1 . . . . A 14 DG H1 . 36746 1 136 . 1 . 1 14 14 DG H1' H 1 6.157 0.002 . 1 . . . . A 14 DG H1' . 36746 1 137 . 1 . 1 14 14 DG H2' H 1 2.313 0.002 . 1 . . . . A 14 DG H2' . 36746 1 138 . 1 . 1 14 14 DG H2'' H 1 2.776 0.002 . 1 . . . . A 14 DG H2'' . 36746 1 139 . 1 . 1 14 14 DG H21 H 1 6.529 0.002 . 1 . . . . A 14 DG H21 . 36746 1 140 . 1 . 1 14 14 DG H22 H 1 9.496 0.002 . 1 . . . . A 14 DG H22 . 36746 1 141 . 1 . 1 14 14 DG H8 H 1 7.721 0.002 . 1 . . . . A 14 DG H8 . 36746 1 142 . 1 . 1 14 14 DG C1' C 13 84.8 0.01 . 1 . . . . A 14 DG C1' . 36746 1 143 . 1 . 1 14 14 DG C2' C 13 43.41 0.01 . 1 . . . . A 14 DG C2' . 36746 1 144 . 1 . 1 14 14 DG C8 C 13 137.6 0.01 . 1 . . . . A 14 DG C8 . 36746 1 145 . 1 . 1 14 14 DG N1 N 15 143.3 0.01 . 1 . . . . A 14 DG N1 . 36746 1 146 . 1 . 1 15 15 DG H1 H 1 10.81 0.002 . 1 . . . . A 15 DG H1 . 36746 1 147 . 1 . 1 15 15 DG H1' H 1 6.345 0.002 . 1 . . . . A 15 DG H1' . 36746 1 148 . 1 . 1 15 15 DG H2' H 1 2.645 0.002 . 1 . . . . A 15 DG H2' . 36746 1 149 . 1 . 1 15 15 DG H2'' H 1 2.777 0.002 . 1 . . . . A 15 DG H2'' . 36746 1 150 . 1 . 1 15 15 DG H8 H 1 8.017 0.002 . 1 . . . . A 15 DG H8 . 36746 1 151 . 1 . 1 15 15 DG C1' C 13 85.44 0.01 . 1 . . . . A 15 DG C1' . 36746 1 152 . 1 . 1 15 15 DG C2' C 13 43.08 0.01 . 1 . . . . A 15 DG C2' . 36746 1 153 . 1 . 1 15 15 DG C8 C 13 139.1 0.01 . 1 . . . . A 15 DG C8 . 36746 1 154 . 1 . 1 15 15 DG N1 N 15 145 0.01 . 1 . . . . A 15 DG N1 . 36746 1 155 . 1 . 1 16 16 DT H1' H 1 6.489 0.002 . 1 . . . . A 16 DT H1' . 36746 1 156 . 1 . 1 16 16 DT H2' H 1 2.428 0.002 . 1 . . . . A 16 DT H2' . 36746 1 157 . 1 . 1 16 16 DT H2'' H 1 2.641 0.002 . 1 . . . . A 16 DT H2'' . 36746 1 158 . 1 . 1 16 16 DT H6 H 1 7.828 0.002 . 1 . . . . A 16 DT H6 . 36746 1 159 . 1 . 1 16 16 DT H71 H 1 1.994 0.002 . 1 . . . . A 16 DT H71 . 36746 1 160 . 1 . 1 16 16 DT H72 H 1 1.994 0.002 . 1 . . . . A 16 DT H72 . 36746 1 161 . 1 . 1 16 16 DT H73 H 1 1.994 0.002 . 1 . . . . A 16 DT H73 . 36746 1 162 . 1 . 1 16 16 DT C1' C 13 87.69 0.01 . 1 . . . . A 16 DT C1' . 36746 1 163 . 1 . 1 16 16 DT C2' C 13 41.23 0.01 . 1 . . . . A 16 DT C2' . 36746 1 164 . 1 . 1 16 16 DT C6 C 13 139.9 0.01 . 1 . . . . A 16 DT C6 . 36746 1 165 . 1 . 1 16 16 DT C7 C 13 14.5 0.01 . 1 . . . . A 16 DT C7 . 36746 1 166 . 1 . 1 17 17 DT H1' H 1 6.633 0.002 . 1 . . . . A 17 DT H1' . 36746 1 167 . 1 . 1 17 17 DT H2' H 1 2.675 0.002 . 1 . . . . A 17 DT H2' . 36746 1 168 . 1 . 1 17 17 DT H2'' H 1 2.675 0.002 . 1 . . . . A 17 DT H2'' . 36746 1 169 . 1 . 1 17 17 DT H6 H 1 7.885 0.002 . 1 . . . . A 17 DT H6 . 36746 1 170 . 1 . 1 17 17 DT H71 H 1 2.14 0.002 . 1 . . . . A 17 DT H71 . 36746 1 171 . 1 . 1 17 17 DT H72 H 1 2.14 0.002 . 1 . . . . A 17 DT H72 . 36746 1 172 . 1 . 1 17 17 DT H73 H 1 2.14 0.002 . 1 . . . . A 17 DT H73 . 36746 1 173 . 1 . 1 17 17 DT C1' C 13 87.07 0.01 . 1 . . . . A 17 DT C1' . 36746 1 174 . 1 . 1 17 17 DT C2' C 13 39.71 0.01 . 1 . . . . A 17 DT C2' . 36746 1 175 . 1 . 1 17 17 DT C6 C 13 140.3 0.01 . 1 . . . . A 17 DT C6 . 36746 1 176 . 1 . 1 17 17 DT C7 C 13 14.93 0.01 . 1 . . . . A 17 DT C7 . 36746 1 177 . 1 . 1 18 18 DG H1 H 1 11.13 0.002 . 1 . . . . A 18 DG H1 . 36746 1 178 . 1 . 1 18 18 DG H1' H 1 5.947 0.002 . 1 . . . . A 18 DG H1' . 36746 1 179 . 1 . 1 18 18 DG H2' H 1 2.821 0.002 . 1 . . . . A 18 DG H2' . 36746 1 180 . 1 . 1 18 18 DG H2'' H 1 3.049 0.002 . 1 . . . . A 18 DG H2'' . 36746 1 181 . 1 . 1 18 18 DG H8 H 1 7.269 0.002 . 1 . . . . A 18 DG H8 . 36746 1 182 . 1 . 1 18 18 DG C1' C 13 89.11 0.01 . 1 . . . . A 18 DG C1' . 36746 1 183 . 1 . 1 18 18 DG C2' C 13 34.93 0.01 . 1 . . . . A 18 DG C2' . 36746 1 184 . 1 . 1 18 18 DG C8 C 13 141.6 0.01 . 1 . . . . A 18 DG C8 . 36746 1 185 . 1 . 1 18 18 DG N1 N 15 143.5 0.01 . 1 . . . . A 18 DG N1 . 36746 1 186 . 1 . 1 19 19 DG H1 H 1 11.4 0.002 . 1 . . . . A 19 DG H1 . 36746 1 187 . 1 . 1 19 19 DG H1' H 1 5.5 0.002 . 1 . . . . A 19 DG H1' . 36746 1 188 . 1 . 1 19 19 DG H2' H 1 2.328 0.002 . 1 . . . . A 19 DG H2' . 36746 1 189 . 1 . 1 19 19 DG H2'' H 1 2.383 0.002 . 1 . . . . A 19 DG H2'' . 36746 1 190 . 1 . 1 19 19 DG H8 H 1 7.546 0.002 . 1 . . . . A 19 DG H8 . 36746 1 191 . 1 . 1 19 19 DG C1' C 13 83.56 0.01 . 1 . . . . A 19 DG C1' . 36746 1 192 . 1 . 1 19 19 DG C2' C 13 41.54 0.01 . 1 . . . . A 19 DG C2' . 36746 1 193 . 1 . 1 19 19 DG C8 C 13 138 0.01 . 1 . . . . A 19 DG C8 . 36746 1 194 . 1 . 1 19 19 DG N1 N 15 144.3 0.01 . 1 . . . . A 19 DG N1 . 36746 1 195 . 1 . 1 20 20 DG H1 H 1 11.64 0.002 . 1 . . . . A 20 DG H1 . 36746 1 196 . 1 . 1 20 20 DG H1' H 1 6.044 0.002 . 1 . . . . A 20 DG H1' . 36746 1 197 . 1 . 1 20 20 DG H2' H 1 2.421 0.002 . 1 . . . . A 20 DG H2' . 36746 1 198 . 1 . 1 20 20 DG H2'' H 1 2.729 0.002 . 1 . . . . A 20 DG H2'' . 36746 1 199 . 1 . 1 20 20 DG H8 H 1 7.68 0.002 . 1 . . . . A 20 DG H8 . 36746 1 200 . 1 . 1 20 20 DG C1' C 13 84.36 0.01 . 1 . . . . A 20 DG C1' . 36746 1 201 . 1 . 1 20 20 DG C2' C 13 39.27 0.01 . 1 . . . . A 20 DG C2' . 36746 1 202 . 1 . 1 20 20 DG C8 C 13 138 0.01 . 1 . . . . A 20 DG C8 . 36746 1 203 . 1 . 1 20 20 DG N1 N 15 145.2 0.01 . 1 . . . . A 20 DG N1 . 36746 1 204 . 1 . 1 21 21 DA H1' H 1 6.195 0.002 . 1 . . . . A 21 DA H1' . 36746 1 205 . 1 . 1 21 21 DA H2 H 1 7.888 0.002 . 1 . . . . A 21 DA H2 . 36746 1 206 . 1 . 1 21 21 DA H2' H 1 1.967 0.002 . 1 . . . . A 21 DA H2' . 36746 1 207 . 1 . 1 21 21 DA H2'' H 1 2.491 0.002 . 1 . . . . A 21 DA H2'' . 36746 1 208 . 1 . 1 21 21 DA H8 H 1 8.042 0.002 . 1 . . . . A 21 DA H8 . 36746 1 209 . 1 . 1 21 21 DA C1' C 13 85.12 0.01 . 1 . . . . A 21 DA C1' . 36746 1 210 . 1 . 1 21 21 DA C2 C 13 156 0.01 . 1 . . . . A 21 DA C2 . 36746 1 211 . 1 . 1 21 21 DA C8 C 13 142.3 0.01 . 1 . . . . A 21 DA C8 . 36746 1 212 . 1 . 1 22 22 DA H1' H 1 5.916 0.002 . 1 . . . . A 22 DA H1' . 36746 1 213 . 1 . 1 22 22 DA H2 H 1 7.377 0.002 . 1 . . . . A 22 DA H2 . 36746 1 214 . 1 . 1 22 22 DA H2' H 1 2.303 0.002 . 1 . . . . A 22 DA H2' . 36746 1 215 . 1 . 1 22 22 DA H2'' H 1 2.423 0.002 . 1 . . . . A 22 DA H2'' . 36746 1 216 . 1 . 1 22 22 DA H8 H 1 7.93 0.002 . 1 . . . . A 22 DA H8 . 36746 1 217 . 1 . 1 22 22 DA C1' C 13 84.65 0.01 . 1 . . . . A 22 DA C1' . 36746 1 218 . 1 . 1 22 22 DA C2 C 13 154.6 0.01 . 1 . . . . A 22 DA C2 . 36746 1 219 . 1 . 1 22 22 DA C2' C 13 42.17 0.01 . 1 . . . . A 22 DA C2' . 36746 1 220 . 1 . 1 22 22 DA C8 C 13 142.2 0.01 . 1 . . . . A 22 DA C8 . 36746 1 stop_ save_