Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR36434
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Nagano, Konami; Kamimura, Takashi; Kawai, Gota. "Interaction between a fluoroquinolone derivative and RNAs with a single bulge." J. Biochem. 171, 239-244 (2022).
PubMed: 34791286
Assembly members:
RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3'), polymer, 20 residues, 6319.79 Da.
1-cyclopropyl-N-[3-(dimethylamino)propyl]-7-(4-ethylpiperazin-1-yl)-6-fluoranyl-4-oxidanylidene-quinoline-3-carboxamide, non-polymer, 443.557 Da.
Natural source: Common Name: not available Taxonomy ID: 10090 Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis Host organism: unidentified
Entity Sequences (FASTA):
RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3'): GGAUGCUUACUCAGCCAUCC
| Data type | Count |
| 1H chemical shifts | 113 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_53D | 2 |
Entity 1, entity_1 20 residues - 6319.79 Da.
| 1 | G | G | A | U | G | C | U | U | A | C | |
| 2 | U | C | A | G | C | C | A | U | C | C |
Entity 2, entity_53D - C24 H34 F N5 O2 - 443.557 Da.
| 1 | 53D |
sample_1: RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3') 0.3 mM; K22 0.3 mM; NaCl 50 mM; Na2HPO4/NaH2PO4 20 mM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 288 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D HOHAHA | sample_1 | isotropic | sample_conditions_1 |
CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - refinement
CNS v1.3, Brunger, Adams, Clore, Gros, Nilges and Read - structure calculation
Sparky v3.114, Goddard - chemical shift assignment
Sparky v3.114, Goddard - peak picking