data_36434 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 36434 _Entry.Title ; Interaction between a fluoroquinolone derivative and RNAs with a single bulge ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2021-07-29 _Entry.Accession_date 2021-07-29 _Entry.Last_release_date 2021-07-29 _Entry.Original_release_date 2021-07-29 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.2.0.16 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype 'SOLUTION NMR' _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 K. Nagano K. . . . 36434 2 T. Kamimura T. . . . 36434 3 G. Kawai G. . . . 36434 stop_ loop_ _Struct_keywords.Keywords _Struct_keywords.Text _Struct_keywords.Entry_ID Complex . 36434 RNA . 36434 fluoroquinolone . 36434 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 36434 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '1H chemical shifts' 113 36434 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2025-12-15 . original BMRB . 36434 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 36435 'Interaction between a fluoroquinolone derivative and RNAs with a single bulge' 36434 BMRB 36542 "Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues" 36434 BMRB 36543 "Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues" 36434 BMRB 36544 "Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues" 36434 BMRB 36545 "Interaction between a fluoroquinolone derivative KG022 and RNAs: effect of base pairs 3' adjacent to the bulge out residues" 36434 BMRB 36587 'Solution structure of a hairpin RNA with the UUCGA loop' 36434 BMRB 36681 "INTERACTION BETWEEN A FLUOROQUINOLONE DERIVATIVE KG022 AND RNAS: EFFECT OF BASE PAIRS 5' ADJACENT TO THE BULGE OUT ESIDUES" 36434 BMRB 36682 "INTERACTION BETWEEN A FLUOROQUINOLONE DERIVATIVE KG022 AND RNAS: EFFECT OF BASE PAIRS 5' ADJACENT TO THE BULGE OUT RESIDUES" 36434 BMRB 36685 "INTERACTION BETWEEN A FLUOROQUINOLONE DERIVATIVE KG022 AND RNAS: EFFECT OF BASE PAIRS 5' ADJACENT TO THE BULGE OUT ESIDUES" 36434 BMRB 36686 "INTERACTION BETWEEN A FLUOROQUINOLONE DERIVATIVE KG022 AND RNAS: EFFECT OF BASE PAIRS 5' ADJACENT TO THE BULGE OUT ESIDUES" 36434 BMRB 36687 "INTERACTION BETWEEN A FLUOROQUINOLONE DERIVATIVE KG022 AND RNAS: EFFECT OF BASE PAIRS 5' ADJACENT TO THE BULGE OUT ESIDUES" 36434 PDB 7FHI 'BMRB Entry Tracking System' 36434 stop_ save_ ############### # Citations # ############### save_citation_1 _Citation.Sf_category citations _Citation.Sf_framecode citation_1 _Citation.Entry_ID 36434 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID 34791286 _Citation.DOI 10.1093/jb/mvab124 _Citation.Full_citation . _Citation.Title ; Interaction between a fluoroquinolone derivative and RNAs with a single bulge. ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Biochem.' _Citation.Journal_name_full 'Journal of biochemistry' _Citation.Journal_volume 171 _Citation.Journal_issue 2 _Citation.Journal_ASTM . _Citation.Journal_ISSN 0021-924X _Citation.Journal_CSD 0353 _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 239 _Citation.Page_last 244 _Citation.Year 2022 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Konami Nagano K. . . . 36434 1 2 Takashi Kamimura T. . . . 36434 1 3 Gota Kawai G. . . . 36434 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly _Assembly.Entry_ID 36434 _Assembly.ID 1 _Assembly.Name 'Interaction between fluoroquinolone derivative and RNAs' _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands 1 _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass 6763.347 _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 entity_1 1 $entity_1 A A yes . . . . . . 36434 1 2 entity_53D 2 $entity_53D B A yes . . . . . . 36434 1 stop_ loop_ _Chem_comp_assembly.Assembly_chem_comp_ID _Chem_comp_assembly.Entity_assembly_ID _Chem_comp_assembly.Entity_ID _Chem_comp_assembly.Comp_index_ID _Chem_comp_assembly.Comp_ID _Chem_comp_assembly.Seq_ID _Chem_comp_assembly.Auth_entity_assembly_ID _Chem_comp_assembly.Auth_asym_ID _Chem_comp_assembly.Auth_seq_ID _Chem_comp_assembly.Auth_comp_ID _Chem_comp_assembly.Auth_variant_ID _Chem_comp_assembly.Sequence_linking _Chem_comp_assembly.Cis_residue _Chem_comp_assembly.NEF_index _Chem_comp_assembly.Entry_ID _Chem_comp_assembly.Assembly_ID . 1 1 1 G 1 . A 1 G . start . . 36434 1 . 1 1 10 C 10 . A 10 C . middle . . 36434 1 . 1 1 11 U 11 . A 11 U . middle . . 36434 1 . 1 1 12 C 12 . A 12 C . middle . . 36434 1 . 1 1 13 A 13 . A 13 A . middle . . 36434 1 . 1 1 14 G 14 . A 14 G . middle . . 36434 1 . 1 1 15 C 15 . A 15 C . middle . . 36434 1 . 1 1 16 C 16 . A 16 C . middle . . 36434 1 . 1 1 17 A 17 . A 17 A . middle . . 36434 1 . 1 1 18 U 18 . A 18 U . middle . . 36434 1 . 1 1 19 C 19 . A 19 C . middle . . 36434 1 . 1 1 2 G 2 . A 2 G . middle . . 36434 1 . 1 1 20 C 20 . A 20 C . end . . 36434 1 . 1 1 3 A 3 . A 3 A . middle . . 36434 1 . 1 1 4 U 4 . A 4 U . middle . . 36434 1 . 1 1 5 G 5 . A 5 G . middle . . 36434 1 . 1 1 6 C 6 . A 6 C . middle . . 36434 1 . 1 1 7 U 7 . A 7 U . middle . . 36434 1 . 1 1 8 U 8 . A 8 U . middle . . 36434 1 . 1 1 9 A 9 . A 9 A . middle . . 36434 1 . 2 2 1 53D 1 . A 101 53D . . . . 36434 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 36434 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name "RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3')" _Entity.Type polymer _Entity.Polymer_common_type RNA _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAUGCUUACUCAGCCAUCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer no _Entity.Nstd_chirality . _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 20 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 6319.79 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 G . 36434 1 2 2 G . 36434 1 3 3 A . 36434 1 4 4 U . 36434 1 5 5 G . 36434 1 6 6 C . 36434 1 7 7 U . 36434 1 8 8 U . 36434 1 9 9 A . 36434 1 10 10 C . 36434 1 11 11 U . 36434 1 12 12 C . 36434 1 13 13 A . 36434 1 14 14 G . 36434 1 15 15 C . 36434 1 16 16 C . 36434 1 17 17 A . 36434 1 18 18 U . 36434 1 19 19 C . 36434 1 20 20 C . 36434 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 36434 1 . G 2 2 36434 1 . A 3 3 36434 1 . U 4 4 36434 1 . G 5 5 36434 1 . C 6 6 36434 1 . U 7 7 36434 1 . U 8 8 36434 1 . A 9 9 36434 1 . C 10 10 36434 1 . U 11 11 36434 1 . C 12 12 36434 1 . A 13 13 36434 1 . G 14 14 36434 1 . C 15 15 36434 1 . C 16 16 36434 1 . A 17 17 36434 1 . U 18 18 36434 1 . C 19 19 36434 1 . C 20 20 36434 1 stop_ save_ save_entity_53D _Entity.Sf_category entity _Entity.Sf_framecode entity_53D _Entity.Entry_ID 36434 _Entity.ID 2 _Entity.BMRB_code 53D _Entity.Name 1-cyclopropyl-N-[3-(dimethylamino)propyl]-7-(4-ethylpiperazin-1-yl)-6-fluoranyl-4-oxidanylidene-quinoline-3-carboxamide _Entity.Type non-polymer _Entity.Polymer_common_type . _Entity.Polymer_type . _Entity.Polymer_type_details . _Entity.Polymer_strand_ID A _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code . _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID 53D _Entity.Nonpolymer_comp_label $chem_comp_53D _Entity.Number_of_monomers . _Entity.Number_of_nonpolymer_components 1 _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method syn _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 443.557 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 101 53D $chem_comp_53D 36434 2 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 36434 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 10090 'no natural source' . 'Mus musculus' . . . . . . . . . . . . . . . . . . . . 36434 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 36434 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' unidentified . . . . . . . . . . . . . . . 36434 1 stop_ save_ ################################# # Polymer residues and ligands # ################################# save_chem_comp_53D _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_53D _Chem_comp.Entry_ID 36434 _Chem_comp.ID 53D _Chem_comp.Provenance . _Chem_comp.Name 1-cyclopropyl-N-[3-(dimethylamino)propyl]-7-(4-ethylpiperazin-1-yl)-6-fluoranyl-4-oxidanylidene-quinoline-3-carboxamide _Chem_comp.Type non-polymer _Chem_comp.BMRB_code . _Chem_comp.PDB_code 53D _Chem_comp.Ambiguous_flag . _Chem_comp.Initial_date . _Chem_comp.Modified_date . _Chem_comp.Release_status . _Chem_comp.Replaced_by . _Chem_comp.Replaces . _Chem_comp.One_letter_code . _Chem_comp.Three_letter_code . _Chem_comp.Number_atoms_all . _Chem_comp.Number_atoms_nh . _Chem_comp.Atom_nomenclature_source . _Chem_comp.PubChem_code . _Chem_comp.Subcomponent_list . _Chem_comp.InChI_code . _Chem_comp.Mon_nstd_flag no _Chem_comp.Mon_nstd_class . _Chem_comp.Mon_nstd_details . _Chem_comp.Mon_nstd_parent . _Chem_comp.Mon_nstd_parent_comp_ID . _Chem_comp.Std_deriv_one_letter_code . _Chem_comp.Std_deriv_three_letter_code . _Chem_comp.Std_deriv_BMRB_code . _Chem_comp.Std_deriv_PDB_code . _Chem_comp.Std_deriv_chem_comp_name . _Chem_comp.Synonyms . _Chem_comp.Formal_charge . _Chem_comp.Paramagnetic . _Chem_comp.Aromatic . _Chem_comp.Formula 'C24 H34 F N5 O2' _Chem_comp.Formula_weight 443.557 _Chem_comp.Formula_mono_iso_wt_nat . _Chem_comp.Formula_mono_iso_wt_13C . _Chem_comp.Formula_mono_iso_wt_15N . _Chem_comp.Formula_mono_iso_wt_13C_15N . _Chem_comp.Image_file_name . _Chem_comp.Image_file_format . _Chem_comp.Topo_file_name . _Chem_comp.Topo_file_format . _Chem_comp.Struct_file_name . _Chem_comp.Struct_file_format . _Chem_comp.Stereochem_param_file_name . _Chem_comp.Stereochem_param_file_format . _Chem_comp.Model_details . _Chem_comp.Model_erf . _Chem_comp.Model_source . _Chem_comp.Model_coordinates_details . _Chem_comp.Model_coordinates_missing_flag . _Chem_comp.Ideal_coordinates_details . _Chem_comp.Ideal_coordinates_missing_flag . _Chem_comp.Model_coordinates_db_code . _Chem_comp.Processing_site . _Chem_comp.Vendor . _Chem_comp.Vendor_product_code . _Chem_comp.Details . _Chem_comp.DB_query_date . _Chem_comp.DB_last_query_revised_last_date . save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 36434 _Sample.ID 1 _Sample.Name . _Sample.Type solution _Sample.Sub_type . _Sample.Details "0.3 mM RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3'), 0.3 mM K22, 95% H2O/5% D2O" _Sample.Aggregate_sample_number . _Sample.Solvent_system '95% H2O/5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 "RNA (5'-R(*GP*GP*AP*UP*GP*CP*UP*UP*AP*CP*UP*CP*AP*GP*CP*CP*AP*UP*CP*C)-3')" 'natural abundance' 1 $assembly 1 $entity_1 . RNA 0.3 . . mM . . . . 36434 1 2 K22 'natural abundance' 1 $assembly 2 $entity_53D . ligand 0.3 . . mM . . . . 36434 1 3 NaCl 'natural abundance' . . . . . salt 50 . . mM . . . . 36434 1 4 Na2HPO4/NaH2PO4 'natural abundance' . . . . . buffer 20 . . mM . . . . 36434 1 5 H2O 'natural abundance' . . . . . solvent 95 . . % . . . . 36434 1 6 D2O [U-2H] . . . . . solvent 5 . . % . . . . 36434 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 36434 _Sample_condition_list.ID 1 _Sample_condition_list.Name . _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 50 . mM 36434 1 pH 6.5 . pH 36434 1 pressure 1 . atm 36434 1 temperature 288 . K 36434 1 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 36434 _Software.ID 1 _Software.Type . _Software.Name CNS _Software.Version 1.3 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 36434 1 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID refinement . 36434 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 36434 _Software.ID 2 _Software.Type . _Software.Name CNS _Software.Version 1.3 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID 'Brunger, Adams, Clore, Gros, Nilges and Read' . . 36434 2 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'structure calculation' . 36434 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 36434 _Software.ID 3 _Software.Type . _Software.Name Sparky _Software.Version 3.114 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 36434 3 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 36434 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 36434 _Software.ID 4 _Software.Type . _Software.Name Sparky _Software.Version 3.114 _Software.DOI . _Software.Details . loop_ _Vendor.Name _Vendor.Address _Vendor.Electronic_address _Vendor.Entry_ID _Vendor.Software_ID Goddard . . 36434 4 stop_ loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'peak picking' . 36434 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 36434 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name . _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model AVANCE _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_NMR_spectrometer_list_1 _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode NMR_spectrometer_list_1 _NMR_spectrometer_list.Entry_ID 36434 _NMR_spectrometer_list.ID 1 _NMR_spectrometer_list.Name . loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer_1 Bruker AVANCE . 600 . . . 36434 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 36434 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D NOESY' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36434 1 2 '2D HOHAHA' . . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 36434 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 36434 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name . _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0 external indirect 1.0 . . . . . 36434 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 36434 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name . _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 '2D NOESY' 1 $sample_1 isotropic 36434 1 2 '2D HOHAHA' 1 $sample_1 isotropic 36434 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.686 0.0019 . 1 . . . . A 1 G H1' . 36434 1 2 . 1 . 1 1 1 G H2' H 1 4.850 0.003 . 1 . . . . A 1 G H2' . 36434 1 3 . 1 . 1 1 1 G H3' H 1 4.519 0.0045 . 1 . . . . A 1 G H3' . 36434 1 4 . 1 . 1 1 1 G H4' H 1 4.311 0.000 . 1 . . . . A 1 G H4' . 36434 1 5 . 1 . 1 1 1 G H5' H 1 3.990 0.000 . 1 . . . . A 1 G H5' . 36434 1 6 . 1 . 1 1 1 G H5'' H 1 3.885 0.000 . 1 . . . . A 1 G H5'' . 36434 1 7 . 1 . 1 2 2 G H1 H 1 12.490 0.0024 . 1 . . . . A 2 G H1 . 36434 1 8 . 1 . 1 2 2 G H1' H 1 5.859 0.0013 . 1 . . . . A 2 G H1' . 36434 1 9 . 1 . 1 2 2 G H2' H 1 4.638 0.0036 . 1 . . . . A 2 G H2' . 36434 1 10 . 1 . 1 2 2 G H3' H 1 4.523 0.002 . 1 . . . . A 2 G H3' . 36434 1 11 . 1 . 1 3 3 A H1' H 1 5.997 0.0013 . 1 . . . . A 3 A H1' . 36434 1 12 . 1 . 1 3 3 A H2 H 1 7.796 0.0017 . 1 . . . . A 3 A H2 . 36434 1 13 . 1 . 1 3 3 A H2' H 1 4.468 0.0005 . 1 . . . . A 3 A H2' . 36434 1 14 . 1 . 1 3 3 A H3' H 1 4.644 0.0017 . 1 . . . . A 3 A H3' . 36434 1 15 . 1 . 1 4 4 U H1' H 1 5.756 0.000 . 1 . . . . A 4 U H1' . 36434 1 16 . 1 . 1 4 4 U H2' H 1 4.303 0.000 . 1 . . . . A 4 U H2' . 36434 1 17 . 1 . 1 4 4 U H3 H 1 13.370 0.002 . 1 . . . . A 4 U H3 . 36434 1 18 . 1 . 1 4 4 U H5 H 1 5.171 0.0041 . 1 . . . . A 4 U H5 . 36434 1 19 . 1 . 1 4 4 U H6 H 1 7.513 0.0022 . 1 . . . . A 4 U H6 . 36434 1 20 . 1 . 1 5 5 G H1 H 1 12.390 0.0031 . 1 . . . . A 5 G H1 . 36434 1 21 . 1 . 1 5 5 G H1' H 1 5.567 0.002 . 1 . . . . A 5 G H1' . 36434 1 22 . 1 . 1 6 6 C H1' H 1 5.336 0.0012 . 1 . . . . A 6 C H1' . 36434 1 23 . 1 . 1 6 6 C H5 H 1 5.145 0.0018 . 1 . . . . A 6 C H5 . 36434 1 24 . 1 . 1 6 6 C H6 H 1 7.498 0.0028 . 1 . . . . A 6 C H6 . 36434 1 25 . 1 . 1 6 6 C H41 H 1 8.436 0.0018 . 1 . . . . A 6 C H41 . 36434 1 26 . 1 . 1 6 6 C H42 H 1 6.648 0.0007 . 1 . . . . A 6 C H42 . 36434 1 27 . 1 . 1 7 7 U H1' H 1 5.529 0.0076 . 1 . . . . A 7 U H1' . 36434 1 28 . 1 . 1 7 7 U H5 H 1 5.250 0.0038 . 1 . . . . A 7 U H5 . 36434 1 29 . 1 . 1 7 7 U H6 H 1 7.725 0.0026 . 1 . . . . A 7 U H6 . 36434 1 30 . 1 . 1 8 8 U H1' H 1 5.909 0.0074 . 1 . . . . A 8 U H1' . 36434 1 31 . 1 . 1 8 8 U H2' H 1 4.463 0.0053 . 1 . . . . A 8 U H2' . 36434 1 32 . 1 . 1 8 8 U H3' H 1 4.495 0.0176 . 1 . . . . A 8 U H3' . 36434 1 33 . 1 . 1 8 8 U H5 H 1 5.799 0.004 . 1 . . . . A 8 U H5 . 36434 1 34 . 1 . 1 8 8 U H6 H 1 7.886 0.0074 . 1 . . . . A 8 U H6 . 36434 1 35 . 1 . 1 9 9 A H1' H 1 5.436 0.001 . 1 . . . . A 9 A H1' . 36434 1 36 . 1 . 1 9 9 A H2 H 1 7.340 0.000 . 1 . . . . A 9 A H2 . 36434 1 37 . 1 . 1 10 10 C H1' H 1 5.725 0.0049 . 1 . . . . A 10 C H1' . 36434 1 38 . 1 . 1 10 10 C H2' H 1 4.727 0.0108 . 1 . . . . A 10 C H2' . 36434 1 39 . 1 . 1 10 10 C H3' H 1 4.473 0.0005 . 1 . . . . A 10 C H3' . 36434 1 40 . 1 . 1 10 10 C H5 H 1 5.808 0.0019 . 1 . . . . A 10 C H5 . 36434 1 41 . 1 . 1 10 10 C H6 H 1 7.869 0.0079 . 1 . . . . A 10 C H6 . 36434 1 42 . 1 . 1 11 11 U H1' H 1 5.947 0.0051 . 1 . . . . A 11 U H1' . 36434 1 43 . 1 . 1 11 11 U H2' H 1 4.263 0.1412 . 1 . . . . A 11 U H2' . 36434 1 44 . 1 . 1 11 11 U H3' H 1 4.542 0.007 . 1 . . . . A 11 U H3' . 36434 1 45 . 1 . 1 11 11 U H5 H 1 5.800 0.0065 . 1 . . . . A 11 U H5 . 36434 1 46 . 1 . 1 11 11 U H6 H 1 7.772 0.0044 . 1 . . . . A 11 U H6 . 36434 1 47 . 1 . 1 12 12 C H1' H 1 5.725 0.000 . 1 . . . . A 12 C H1' . 36434 1 48 . 1 . 1 12 12 C H5 H 1 5.316 0.0058 . 1 . . . . A 12 C H5 . 36434 1 49 . 1 . 1 12 12 C H6 H 1 7.426 0.001 . 1 . . . . A 12 C H6 . 36434 1 50 . 1 . 1 13 13 A H1' H 1 5.875 0.0029 . 1 . . . . A 13 A H1' . 36434 1 51 . 1 . 1 13 13 A H2 H 1 7.338 0.0025 . 1 . . . . A 13 A H2 . 36434 1 52 . 1 . 1 13 13 A H2' H 1 4.700 0.0017 . 1 . . . . A 13 A H2' . 36434 1 53 . 1 . 1 13 13 A H3' H 1 4.554 0.0022 . 1 . . . . A 13 A H3' . 36434 1 54 . 1 . 1 14 14 G H1 H 1 13.290 0.0054 . 1 . . . . A 14 G H1 . 36434 1 55 . 1 . 1 14 14 G H1' H 1 5.718 0.0015 . 1 . . . . A 14 G H1' . 36434 1 56 . 1 . 1 14 14 G H2' H 1 4.226 0.0009 . 1 . . . . A 14 G H2' . 36434 1 57 . 1 . 1 14 14 G H3' H 1 4.603 0.0028 . 1 . . . . A 14 G H3' . 36434 1 58 . 1 . 1 15 15 C H1' H 1 5.702 0.0064 . 1 . . . . A 15 C H1' . 36434 1 59 . 1 . 1 15 15 C H2' H 1 3.849 0.0005 . 1 . . . . A 15 C H2' . 36434 1 60 . 1 . 1 15 15 C H3' H 1 4.371 0.0016 . 1 . . . . A 15 C H3' . 36434 1 61 . 1 . 1 15 15 C H5 H 1 5.244 0.0045 . 1 . . . . A 15 C H5 . 36434 1 62 . 1 . 1 15 15 C H6 H 1 7.288 0.0013 . 1 . . . . A 15 C H6 . 36434 1 63 . 1 . 1 15 15 C H41 H 1 8.142 0.0025 . 1 . . . . A 15 C H41 . 36434 1 64 . 1 . 1 15 15 C H42 H 1 7.063 0.002 . 1 . . . . A 15 C H42 . 36434 1 65 . 1 . 1 16 16 C H1' H 1 6.240 0.0021 . 1 . . . . A 16 C H1' . 36434 1 66 . 1 . 1 16 16 C H2' H 1 4.450 0.0096 . 1 . . . . A 16 C H2' . 36434 1 67 . 1 . 1 16 16 C H3' H 1 4.673 0.1303 . 1 . . . . A 16 C H3' . 36434 1 68 . 1 . 1 16 16 C H4' H 1 4.576 0.000 . 1 . . . . A 16 C H4' . 36434 1 69 . 1 . 1 16 16 C H5 H 1 6.126 0.002 . 1 . . . . A 16 C H5 . 36434 1 70 . 1 . 1 16 16 C H6 H 1 7.969 0.0053 . 1 . . . . A 16 C H6 . 36434 1 71 . 1 . 1 17 17 A H1' H 1 5.568 0.000 . 1 . . . . A 17 A H1' . 36434 1 72 . 1 . 1 17 17 A H2 H 1 7.375 0.0007 . 1 . . . . A 17 A H2 . 36434 1 73 . 1 . 1 17 17 A H61 H 1 7.510 0.0011 . 1 . . . . A 17 A H61 . 36434 1 74 . 1 . 1 17 17 A H62 H 1 6.818 0.0024 . 1 . . . . A 17 A H62 . 36434 1 75 . 1 . 1 18 18 U H1' H 1 5.539 0.0025 . 1 . . . . A 18 U H1' . 36434 1 76 . 1 . 1 18 18 U H3 H 1 14.280 0.0033 . 1 . . . . A 18 U H3 . 36434 1 77 . 1 . 1 18 18 U H5 H 1 4.983 0.004 . 1 . . . . A 18 U H5 . 36434 1 78 . 1 . 1 18 18 U H6 H 1 7.636 0.0034 . 1 . . . . A 18 U H6 . 36434 1 79 . 1 . 1 19 19 C H1' H 1 5.566 0.000 . 1 . . . . A 19 C H1' . 36434 1 80 . 1 . 1 19 19 C H5 H 1 5.570 0.0035 . 1 . . . . A 19 C H5 . 36434 1 81 . 1 . 1 19 19 C H6 H 1 7.834 0.0024 . 1 . . . . A 19 C H6 . 36434 1 82 . 1 . 1 19 19 C H41 H 1 8.375 0.0045 . 1 . . . . A 19 C H41 . 36434 1 83 . 1 . 1 19 19 C H42 H 1 6.949 0.0016 . 1 . . . . A 19 C H42 . 36434 1 84 . 1 . 1 20 20 C H1' H 1 5.684 0.0093 . 1 . . . . A 20 C H1' . 36434 1 85 . 1 . 1 20 20 C H2' H 1 4.010 0.005 . 1 . . . . A 20 C H2' . 36434 1 86 . 1 . 1 20 20 C H3' H 1 4.416 0.0029 . 1 . . . . A 20 C H3' . 36434 1 87 . 1 . 1 20 20 C H5 H 1 5.468 0.0026 . 1 . . . . A 20 C H5 . 36434 1 88 . 1 . 1 20 20 C H6 H 1 7.639 0.0018 . 1 . . . . A 20 C H6 . 36434 1 89 . 1 . 1 20 20 C H41 H 1 8.221 0.0044 . 1 . . . . A 20 C H41 . 36434 1 90 . 1 . 1 20 20 C H42 H 1 6.940 0.0008 . 1 . . . . A 20 C H42 . 36434 1 91 . 2 . 2 1 1 53D H10 H 1 6.899 0.0029 . 1 . . . . A 101 53D H10 . 36434 1 92 . 2 . 2 1 1 53D H11 H 1 2.495 0.0027 . 1 . . . . A 101 53D H11 . 36434 1 93 . 2 . 2 1 1 53D H121 H 1 0.745 0.0032 . 1 . . . . A 101 53D H121 . 36434 1 94 . 2 . 2 1 1 53D H132 H 1 0.423 0.0007 . 1 . . . . A 101 53D H132 . 36434 1 95 . 2 . 2 1 1 53D H131 H 1 0.365 0.0021 . 1 . . . . A 101 53D H131 . 36434 1 96 . 2 . 2 1 1 53D H151 H 1 3.011 0.0171 . 1 . . . . A 101 53D H151 . 36434 1 97 . 2 . 2 1 1 53D H161 H 1 3.589 0.0041 . 1 . . . . A 101 53D H161 . 36434 1 98 . 2 . 2 1 1 53D H162 H 1 3.167 0.0037 . 1 . . . . A 101 53D H162 . 36434 1 99 . 2 . 2 1 1 53D H181 H 1 2.888 0.0019 . 1 . . . . A 101 53D H181 . 36434 1 100 . 2 . 2 1 1 53D H191 H 1 3.441 0.0124 . 1 . . . . A 101 53D H191 . 36434 1 101 . 2 . 2 1 1 53D H201 H 1 3.251 0.0025 . 1 . . . . A 101 53D H201 . 36434 1 102 . 2 . 2 1 1 53D H211 H 1 1.328 0.0039 . 1 . . . . A 101 53D H211 . 36434 1 103 . 2 . 2 1 1 53D H212 H 1 1.328 0.0039 . 1 . . . . A 101 53D H212 . 36434 1 104 . 2 . 2 1 1 53D H213 H 1 1.328 0.0039 . 1 . . . . A 101 53D H213 . 36434 1 105 . 2 . 2 1 1 53D H23 H 1 10.050 0.0013 . 1 . . . . A 101 53D H23 . 36434 1 106 . 2 . 2 1 1 53D H241 H 1 3.468 0.0014 . 1 . . . . A 101 53D H241 . 36434 1 107 . 2 . 2 1 1 53D H251 H 1 2.112 0.0047 . 1 . . . . A 101 53D H251 . 36434 1 108 . 2 . 2 1 1 53D H261 H 1 3.298 0.0097 . 1 . . . . A 101 53D H261 . 36434 1 109 . 2 . 2 1 1 53D H281 H 1 2.954 0.0025 . 1 . . . . A 101 53D H281 . 36434 1 110 . 2 . 2 1 1 53D H282 H 1 2.954 0.0025 . 1 . . . . A 101 53D H282 . 36434 1 111 . 2 . 2 1 1 53D H283 H 1 2.954 0.0025 . 1 . . . . A 101 53D H283 . 36434 1 112 . 2 . 2 1 1 53D H6 H 1 7.815 0.0013 . 1 . . . . A 101 53D H6 . 36434 1 113 . 2 . 2 1 1 53D H7 H 1 6.636 0.0033 . 1 . . . . A 101 53D H7 . 36434 1 stop_ save_