Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53721
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Owusu Ansah, Shilla; Camara, Momodou; Eichhorn, Catherine. "Quantifying Mg2+ dependence on conformational equilibrium in the two-state 7SK RNA stem-loop 3" Nucleic Acids Res. ., .-..
Assembly members:
entity_1, polymer, 37 residues, Formula weight is not available
entity_MG, non-polymer, 24.305 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCCUCCAAACAAGCUCUCA
AGGUCCAUUUGUAGGCC
| Data type | Count |
| 13C chemical shifts | 92 |
| 15N chemical shifts | 10 |
| 1H chemical shifts | 219 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 7SK SL3e-top RNA | 1 |
| 2 | Mg ion | 2 |
Entity 1, 7SK SL3e-top RNA 37 residues - Formula weight is not available
| 1 | G | G | C | C | U | C | C | A | A | A | ||||
| 2 | C | A | A | G | C | U | C | U | C | A | ||||
| 3 | A | G | G | U | C | C | A | U | U | U | ||||
| 4 | G | U | A | G | G | C | C |
Entity 2, Mg ion - Mg - 24.305 Da.
| 1 | MG |
sample_1: 7SK SL3e-top RNA + Mg 0.65 mM; 7SK SL3e-top RNA + Mg, [U-100% 15N], 0.65 mM; 7SK SL3e-top RNA + Mg, [U-100% 13C], 0.65 mM; D2O, [U-100% 2H], 5%; sodium phosphate 20 mM; KCl 50 mM
sample_conditions_1: ionic strength: 0.07 M; pH: 7.5; pressure: 1 atm; temperature: 298.1 K
sample_conditions_2: ionic strength: 0.07 M; pH: 7.5; pressure: 1 atm; temperature: 313.1 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
NMRFAM-SPARKY - chemical shift assignment