data_53721 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 53721 _Entry.Title ; Solution NMR chemical shift assignments for a construct of the top fragment of 7SK SL3 RNA in the SL3e state with MgCl2 at pH 7.5 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2026-04-14 _Entry.Accession_date 2026-04-14 _Entry.Last_release_date 2026-04-14 _Entry.Original_release_date 2026-04-14 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.14.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID 1 _Entry.Generated_software_label $software_1 _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details 'Solution NMR chemical shift assignments for the upper region of 7SK SL3e RNA (SL3e-top)' _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Shilla 'Owusu Ansah' . . . 0000-0003-0870-1373 53721 2 Momodou Camara . B. . 0000-0003-0922-4943 53721 3 Catherine Eichhorn . D. . 0000-0001-8624-1961 53721 stop_ loop_ _Entry_src.ID _Entry_src.Project_name _Entry_src.Organization_full_name _Entry_src.Organization_initials _Entry_src.Entry_ID 1 . 'University of Nebraska Lincoln' . 53721 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 2 53721 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 92 53721 '15N chemical shifts' 10 53721 '1H chemical shifts' 219 53721 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2026-04-28 . original BMRB . 53721 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 53720 7SK_SL3e-top_pH75_no-Mg 53721 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 53721 _Citation.ID 1 _Citation.Name . _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Quantifying Mg2+ dependence on conformational equilibrium in the two-state 7SK RNA stem-loop 3 ; _Citation.Status submitted _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Shilla 'Owusu Ansah' . . . . 53721 1 2 Momodou Camara . B. . . 53721 1 3 Catherine Eichhorn . D. . . 53721 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 53721 _Assembly.ID 1 _Assembly.Name '7SK SL3e-top RNA + Mg' _Assembly.BMRB_code . _Assembly.Number_of_components 2 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 '7SK SL3e-top RNA' 1 $entity_1 . . yes native no no . . . 53721 1 2 'Mg ion' 2 $entity_MG . . no native no no . . . 53721 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 53721 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCCUCCAAACAAGCUCUCA AGGUCCAUUUGUAGGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 37 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 219 G . 53721 1 2 220 G . 53721 1 3 221 C . 53721 1 4 222 C . 53721 1 5 223 U . 53721 1 6 224 C . 53721 1 7 225 C . 53721 1 8 226 A . 53721 1 9 227 A . 53721 1 10 228 A . 53721 1 11 229 C . 53721 1 12 230 A . 53721 1 13 231 A . 53721 1 14 232 G . 53721 1 15 233 C . 53721 1 16 234 U . 53721 1 17 235 C . 53721 1 18 236 U . 53721 1 19 237 C . 53721 1 20 238 A . 53721 1 21 239 A . 53721 1 22 240 G . 53721 1 23 241 G . 53721 1 24 242 U . 53721 1 25 243 C . 53721 1 26 244 C . 53721 1 27 245 A . 53721 1 28 246 U . 53721 1 29 247 U . 53721 1 30 248 U . 53721 1 31 249 G . 53721 1 32 250 U . 53721 1 33 251 A . 53721 1 34 252 G . 53721 1 35 253 G . 53721 1 36 254 C . 53721 1 37 255 C . 53721 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 53721 1 . G 2 2 53721 1 . C 3 3 53721 1 . C 4 4 53721 1 . U 5 5 53721 1 . C 6 6 53721 1 . C 7 7 53721 1 . A 8 8 53721 1 . A 9 9 53721 1 . A 10 10 53721 1 . C 11 11 53721 1 . A 12 12 53721 1 . A 13 13 53721 1 . G 14 14 53721 1 . C 15 15 53721 1 . U 16 16 53721 1 . C 17 17 53721 1 . U 18 18 53721 1 . C 19 19 53721 1 . A 20 20 53721 1 . A 21 21 53721 1 . G 22 22 53721 1 . G 23 23 53721 1 . U 24 24 53721 1 . C 25 25 53721 1 . C 26 26 53721 1 . A 27 27 53721 1 . U 28 28 53721 1 . U 29 29 53721 1 . U 30 30 53721 1 . G 31 31 53721 1 . U 32 32 53721 1 . A 33 33 53721 1 . G 34 34 53721 1 . G 35 35 53721 1 . C 36 36 53721 1 . C 37 37 53721 1 stop_ save_ save_entity_MG _Entity.Sf_category entity _Entity.Sf_framecode entity_MG _Entity.Entry_ID 53721 _Entity.ID 2 _Entity.BMRB_code MG _Entity.Name entity_MG _Entity.Type non-polymer _Entity.Polymer_common_type . _Entity.Polymer_type . _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code . _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID MG _Entity.Nonpolymer_comp_label $chem_comp_MG _Entity.Number_of_monomers . _Entity.Number_of_nonpolymer_components 1 _Entity.Paramagnetic . _Entity.Thiol_state . _Entity.Src_method . _Entity.Parent_entity_ID 2 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 24.305 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID 'MAGNESIUM ION' BMRB 53721 2 stop_ loop_ _Entity_systematic_name.Name _Entity_systematic_name.Naming_system _Entity_systematic_name.Entry_ID _Entity_systematic_name.Entity_ID 'MAGNESIUM ION' BMRB 53721 2 MG 'Three letter code' 53721 2 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 1 MG $chem_comp_MG 53721 2 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 53721 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 9606 organism . 'Homo sapiens' Human . . Eukaryota Metazoa Homo sapiens . . . . . . . . . . . . . 53721 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 53721 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'chemical synthesis' . . . . . . . . . . . . . . . . 53721 1 stop_ save_ ################################# # Polymer residues and ligands # ################################# save_chem_comp_MG _Chem_comp.Sf_category chem_comp _Chem_comp.Sf_framecode chem_comp_MG _Chem_comp.Entry_ID 53721 _Chem_comp.ID MG _Chem_comp.Provenance PDB _Chem_comp.Name 'MAGNESIUM ION' _Chem_comp.Type NON-POLYMER _Chem_comp.BMRB_code MG _Chem_comp.PDB_code MG _Chem_comp.Ambiguous_flag no _Chem_comp.Initial_date 2020-07-10 _Chem_comp.Modified_date 2020-07-10 _Chem_comp.Release_status REL _Chem_comp.Replaced_by . _Chem_comp.Replaces . _Chem_comp.One_letter_code . _Chem_comp.Three_letter_code MG _Chem_comp.Number_atoms_all 1 _Chem_comp.Number_atoms_nh 1 _Chem_comp.Atom_nomenclature_source . _Chem_comp.PubChem_code . _Chem_comp.Subcomponent_list . _Chem_comp.InChI_code InChI=1S/Mg/q+2 _Chem_comp.Mon_nstd_flag no _Chem_comp.Mon_nstd_class . _Chem_comp.Mon_nstd_details . _Chem_comp.Mon_nstd_parent . _Chem_comp.Mon_nstd_parent_comp_ID . _Chem_comp.Std_deriv_one_letter_code . _Chem_comp.Std_deriv_three_letter_code . _Chem_comp.Std_deriv_BMRB_code . _Chem_comp.Std_deriv_PDB_code . _Chem_comp.Std_deriv_chem_comp_name . _Chem_comp.Synonyms . _Chem_comp.Formal_charge 2 _Chem_comp.Paramagnetic . _Chem_comp.Aromatic no _Chem_comp.Formula Mg _Chem_comp.Formula_weight 24.305 _Chem_comp.Formula_mono_iso_wt_nat . _Chem_comp.Formula_mono_iso_wt_13C . _Chem_comp.Formula_mono_iso_wt_15N . _Chem_comp.Formula_mono_iso_wt_13C_15N . _Chem_comp.Image_file_name . _Chem_comp.Image_file_format . _Chem_comp.Topo_file_name . _Chem_comp.Topo_file_format . _Chem_comp.Struct_file_name . _Chem_comp.Struct_file_format . _Chem_comp.Stereochem_param_file_name . _Chem_comp.Stereochem_param_file_format . _Chem_comp.Model_details . _Chem_comp.Model_erf . _Chem_comp.Model_source . _Chem_comp.Model_coordinates_details . _Chem_comp.Model_coordinates_missing_flag no _Chem_comp.Ideal_coordinates_details . _Chem_comp.Ideal_coordinates_missing_flag no _Chem_comp.Model_coordinates_db_code . _Chem_comp.Processing_site PDBJ _Chem_comp.Vendor . _Chem_comp.Vendor_product_code . _Chem_comp.Details . _Chem_comp.DB_query_date . _Chem_comp.DB_last_query_revised_last_date . loop_ _Chem_comp_descriptor.Descriptor _Chem_comp_descriptor.Type _Chem_comp_descriptor.Program _Chem_comp_descriptor.Program_version _Chem_comp_descriptor.Entry_ID _Chem_comp_descriptor.Comp_ID InChI=1S/Mg/q+2 InChI InChI 1.03 53721 MG JLVVSXFLKOJNIY-UHFFFAOYSA-N InChIKey InChI 1.03 53721 MG [Mg++] SMILES CACTVS 3.341 53721 MG [Mg++] SMILES_CANONICAL CACTVS 3.341 53721 MG [Mg+2] SMILES ACDLabs 10.04 53721 MG [Mg+2] SMILES 'OpenEye OEToolkits' 1.5.0 53721 MG [Mg+2] SMILES_CANONICAL 'OpenEye OEToolkits' 1.5.0 53721 MG stop_ loop_ _Chem_comp_identifier.Identifier _Chem_comp_identifier.Type _Chem_comp_identifier.Program _Chem_comp_identifier.Program_version _Chem_comp_identifier.Entry_ID _Chem_comp_identifier.Comp_ID magnesium 'SYSTEMATIC NAME' ACDLabs 10.04 53721 MG 'magnesium(+2) cation' 'SYSTEMATIC NAME' 'OpenEye OEToolkits' 1.5.0 53721 MG stop_ loop_ _Chem_comp_atom.Atom_ID _Chem_comp_atom.BMRB_code _Chem_comp_atom.PDB_atom_ID _Chem_comp_atom.Alt_atom_ID _Chem_comp_atom.Auth_atom_ID _Chem_comp_atom.Type_symbol _Chem_comp_atom.Isotope_number _Chem_comp_atom.Chirality _Chem_comp_atom.Stereo_config _Chem_comp_atom.Charge _Chem_comp_atom.Partial_charge _Chem_comp_atom.Oxidation_number _Chem_comp_atom.Unpaired_electron_number _Chem_comp_atom.Align _Chem_comp_atom.Aromatic_flag _Chem_comp_atom.Leaving_atom_flag _Chem_comp_atom.Substruct_code _Chem_comp_atom.Ionizable _Chem_comp_atom.Drawing_2D_coord_x _Chem_comp_atom.Drawing_2D_coord_y _Chem_comp_atom.Model_Cartn_x _Chem_comp_atom.Model_Cartn_x_esd _Chem_comp_atom.Model_Cartn_y _Chem_comp_atom.Model_Cartn_y_esd _Chem_comp_atom.Model_Cartn_z _Chem_comp_atom.Model_Cartn_z_esd _Chem_comp_atom.Model_Cartn_x_ideal _Chem_comp_atom.Model_Cartn_y_ideal _Chem_comp_atom.Model_Cartn_z_ideal _Chem_comp_atom.PDBX_ordinal _Chem_comp_atom.Details _Chem_comp_atom.Entry_ID _Chem_comp_atom.Comp_ID MG MG MG MG . MG . . N 2 . . . 0 N N . . . . 0.000 . 0.000 . 0.000 . 0.000 0.000 0.000 1 . 53721 MG stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 53721 _Sample.ID 1 _Sample.Name '7SK SL3e-top RNA + Mg' _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '95% H2O/5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 '7SK SL3e-top RNA + Mg' 'natural abundance' . . 1 $entity_1 . . 0.65 0.5 0.8 mM . . . . 53721 1 2 '7SK SL3e-top RNA + Mg' '[U-100% 15N]' . . 1 $entity_1 . . 0.65 0.5 0.8 mM . . . . 53721 1 3 '7SK SL3e-top RNA + Mg' '[U-100% 13C]' . . 1 $entity_1 . . 0.65 0.5 0.8 mM . . . . 53721 1 4 D2O '[U-100% 2H]' . . . . . . 5 . . % . . . . 53721 1 5 'sodium phosphate' 'natural abundance' . . . . . . 20 . . mM . . . . 53721 1 6 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 53721 1 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 53721 _Sample_condition_list.ID 1 _Sample_condition_list.Name '20mM sodium phosphate, 50 mM KCl, pH7.5' _Sample_condition_list.Details '278.1-313.1 K' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.07 . M 53721 1 pH 7.5 . pH 53721 1 pressure 1 . atm 53721 1 temperature 298.1 . K 53721 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 53721 _Sample_condition_list.ID 2 _Sample_condition_list.Name '20mM sodium phosphate, 50 mM KCl, pH7.5' _Sample_condition_list.Details '278.1-313.1 K' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 0.07 . M 53721 2 pH 7.5 . pH 53721 2 pressure 1 . atm 53721 2 temperature 313.1 . K 53721 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 53721 _Software.ID 1 _Software.Type . _Software.Name NMRFAM-SPARKY _Software.Version . _Software.DOI . _Software.Details . loop_ _Task.Task _Task.Software_module _Task.Entry_ID _Task.Software_ID 'chemical shift assignment' . 53721 1 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 53721 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker AVANCE NEO 600 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'AVANCE NEO' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 53721 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NUS_flag _Experiment.Interleaved_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Details _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '1D 1H' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53721 1 2 '2D 1H-1H NOESY' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53721 1 3 '2D 1H-13C HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53721 1 4 '2D 1H-15N HSQC' no . . . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . . 53721 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 53721 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name '7SK SL3e-top RNA + Mg' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 water protons . . . . ppm 0 na indirect . . . . . . 53721 1 H 1 water protons . . . . ppm 0 na direct 1 . . . . . 53721 1 N 15 water protons . . . . ppm 0 na indirect . . . . . . 53721 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 53721 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name '7SK SL3e-top RNA + Mg' _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-1H NOESY' . . . 53721 1 3 '2D 1H-13C HSQC' . . . 53721 1 4 '2D 1H-15N HSQC' . . . 53721 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53721 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 4.858 0.00 . . . . . . . 219 G H1' . 53721 1 2 . 1 . 1 1 1 G H8 H 1 8.155 0.01 . . . . . . . 219 G H8 . 53721 1 3 . 1 . 1 1 1 G C8 C 13 139.624 0.00 . . . . . . . 219 G C8 . 53721 1 4 . 1 . 1 2 2 G H1 H 1 13.470 0.00 . . . . . . . 220 G H1 . 53721 1 5 . 1 . 1 2 2 G H1' H 1 5.887 0.00 . . . . . . . 220 G H1' . 53721 1 6 . 1 . 1 2 2 G H8 H 1 7.703 0.00 . . . . . . . 220 G H8 . 53721 1 7 . 1 . 1 2 2 G C8 C 13 136.906 0.00 . . . . . . . 220 G C8 . 53721 1 8 . 1 . 1 2 2 G N1 N 15 148.733 0.00 . . . . . . . 220 G N1 . 53721 1 9 . 1 . 1 3 3 C H5 H 1 5.256 0.00 . . . . . . . 221 C H5 . 53721 1 10 . 1 . 1 3 3 C H6 H 1 7.744 0.00 . . . . . . . 221 C H6 . 53721 1 11 . 1 . 1 3 3 C H41 H 1 8.670 0.00 . . . . . . . 221 C H41 . 53721 1 12 . 1 . 1 3 3 C H42 H 1 6.804 0.00 . . . . . . . 221 C H42 . 53721 1 13 . 1 . 1 3 3 C C6 C 13 140.988 0.00 . . . . . . . 221 C C6 . 53721 1 14 . 1 . 1 4 4 C H5 H 1 5.512 0.00 . . . . . . . 222 C H5 . 53721 1 15 . 1 . 1 4 4 C H6 H 1 7.794 0.00 . . . . . . . 222 C H6 . 53721 1 16 . 1 . 1 4 4 C H41 H 1 8.509 0.00 . . . . . . . 222 C H41 . 53721 1 17 . 1 . 1 4 4 C H42 H 1 6.869 0.00 . . . . . . . 222 C H42 . 53721 1 18 . 1 . 1 4 4 C C6 C 13 141.314 0.00 . . . . . . . 222 C C6 . 53721 1 19 . 1 . 1 5 5 U H1' H 1 5.505 0.00 . . . . . . . 223 U H1' . 53721 1 20 . 1 . 1 5 5 U H5 H 1 5.378 0.00 . . . . . . . 223 U H5 . 53721 1 21 . 1 . 1 5 5 U H6 H 1 7.892 0.00 . . . . . . . 223 U H6 . 53721 1 22 . 1 . 1 5 5 U C6 C 13 142.355 0.00 . . . . . . . 223 U C6 . 53721 1 23 . 1 . 1 6 6 C H1' H 1 5.508 0.00 . . . . . . . 224 C H1' . 53721 1 24 . 1 . 1 6 6 C H5 H 1 5.529 0.00 . . . . . . . 224 C H5 . 53721 1 25 . 1 . 1 6 6 C H6 H 1 7.679 0.00 . . . . . . . 224 C H6 . 53721 1 26 . 1 . 1 6 6 C C6 C 13 141.547 0.01 . . . . . . . 224 C C6 . 53721 1 27 . 1 . 1 7 7 C H1' H 1 5.445 0.00 . . . . . . . 225 C H1' . 53721 1 28 . 1 . 1 7 7 C H5 H 1 5.672 0.00 . . . . . . . 225 C H5 . 53721 1 29 . 1 . 1 7 7 C H6 H 1 7.822 0.00 . . . . . . . 225 C H6 . 53721 1 30 . 1 . 1 7 7 C H41 H 1 8.172 0.00 . . . . . . . 225 C H41 . 53721 1 31 . 1 . 1 7 7 C H42 H 1 7.019 0.00 . . . . . . . 225 C H42 . 53721 1 32 . 1 . 1 7 7 C C6 C 13 140.590 0.00 . . . . . . . 225 C C6 . 53721 1 33 . 1 . 1 8 8 A H1' H 1 5.813 0.00 . . . . . . . 226 A H1' . 53721 1 34 . 1 . 1 8 8 A H2 H 1 6.671 0.00 . . . . . . . 226 A H2 . 53721 1 35 . 1 . 1 8 8 A H8 H 1 7.998 0.00 . . . . . . . 226 A H8 . 53721 1 36 . 1 . 1 8 8 A C2 C 13 152.103 0.00 . . . . . . . 226 A C2 . 53721 1 37 . 1 . 1 8 8 A C8 C 13 139.565 0.00 . . . . . . . 226 A C8 . 53721 1 38 . 1 . 1 9 9 A H2 H 1 7.176 0.00 . . . . . . . 227 A H2 . 53721 1 39 . 1 . 1 9 9 A H8 H 1 7.658 0.00 . . . . . . . 227 A H8 . 53721 1 40 . 1 . 1 9 9 A C2 C 13 152.849 0.00 . . . . . . . 227 A C2 . 53721 1 41 . 1 . 1 9 9 A C8 C 13 139.065 0.00 . . . . . . . 227 A C8 . 53721 1 42 . 1 . 1 10 10 A H1' H 1 5.745 0.00 . . . . . . . 228 A H1' . 53721 1 43 . 1 . 1 10 10 A H2 H 1 7.747 0.00 . . . . . . . 228 A H2 . 53721 1 44 . 1 . 1 10 10 A H8 H 1 7.439 0.00 . . . . . . . 228 A H8 . 53721 1 45 . 1 . 1 10 10 A C2 C 13 154.183 0.00 . . . . . . . 228 A C2 . 53721 1 46 . 1 . 1 10 10 A C8 C 13 138.701 0.00 . . . . . . . 228 A C8 . 53721 1 47 . 1 . 1 11 11 C H1' H 1 5.160 0.00 . . . . . . . 229 C H1' . 53721 1 48 . 1 . 1 11 11 C H5 H 1 5.399 0.00 . . . . . . . 229 C H5 . 53721 1 49 . 1 . 1 11 11 C H6 H 1 7.383 0.00 . . . . . . . 229 C H6 . 53721 1 50 . 1 . 1 11 11 C C6 C 13 140.947 0.00 . . . . . . . 229 C C6 . 53721 1 51 . 1 . 1 12 12 A H1' H 1 5.852 0.00 . . . . . . . 230 A H1' . 53721 1 52 . 1 . 1 12 12 A H2 H 1 7.590 0.00 . . . . . . . 230 A H2 . 53721 1 53 . 1 . 1 12 12 A H8 H 1 7.997 0.00 . . . . . . . 230 A H8 . 53721 1 54 . 1 . 1 12 12 A C2 C 13 153.999 0.00 . . . . . . . 230 A C2 . 53721 1 55 . 1 . 1 12 12 A C8 C 13 140.365 0.00 . . . . . . . 230 A C8 . 53721 1 56 . 1 . 1 13 13 A H1' H 1 5.572 0.00 . . . . . . . 231 A H1' . 53721 1 57 . 1 . 1 13 13 A H2 H 1 7.898 0.00 . . . . . . . 231 A H2 . 53721 1 58 . 1 . 1 13 13 A H8 H 1 7.700 0.01 . . . . . . . 231 A H8 . 53721 1 59 . 1 . 1 13 13 A C2 C 13 154.475 0.00 . . . . . . . 231 A C2 . 53721 1 60 . 1 . 1 13 13 A C8 C 13 138.956 0.00 . . . . . . . 231 A C8 . 53721 1 61 . 1 . 1 14 14 G H1' H 1 5.186 0.00 . . . . . . . 232 G H1' . 53721 1 62 . 1 . 1 14 14 G H8 H 1 7.027 0.00 . . . . . . . 232 G H8 . 53721 1 63 . 1 . 1 14 14 G C8 C 13 136.055 0.00 . . . . . . . 232 G C8 . 53721 1 64 . 1 . 1 15 15 C H1' H 1 5.480 0.00 . . . . . . . 233 C H1' . 53721 1 65 . 1 . 1 15 15 C H5 H 1 5.276 0.00 . . . . . . . 233 C H5 . 53721 1 66 . 1 . 1 15 15 C H6 H 1 7.498 0.00 . . . . . . . 233 C H6 . 53721 1 67 . 1 . 1 15 15 C H41 H 1 8.351 0.00 . . . . . . . 233 C H41 . 53721 1 68 . 1 . 1 15 15 C H42 H 1 6.886 0.00 . . . . . . . 233 C H42 . 53721 1 69 . 1 . 1 15 15 C C6 C 13 140.437 0.00 . . . . . . . 233 C C6 . 53721 1 70 . 1 . 1 16 16 U H5 H 1 5.709 0.00 . . . . . . . 234 U H5 . 53721 1 71 . 1 . 1 16 16 U H6 H 1 7.635 0.00 . . . . . . . 234 U H6 . 53721 1 72 . 1 . 1 16 16 U C6 C 13 140.555 0.00 . . . . . . . 234 U C6 . 53721 1 73 . 1 . 1 17 17 C H5 H 1 5.457 0.00 . . . . . . . 235 C H5 . 53721 1 74 . 1 . 1 17 17 C H6 H 1 7.484 0.00 . . . . . . . 235 C H6 . 53721 1 75 . 1 . 1 17 17 C C6 C 13 141.861 0.01 . . . . . . . 235 C C6 . 53721 1 76 . 1 . 1 18 18 U H5 H 1 5.676 0.00 . . . . . . . 236 U H5 . 53721 1 77 . 1 . 1 18 18 U H6 H 1 7.796 0.00 . . . . . . . 236 U H6 . 53721 1 78 . 1 . 1 18 18 U C6 C 13 143.446 0.00 . . . . . . . 236 U C6 . 53721 1 79 . 1 . 1 19 19 C H5 H 1 5.859 0.00 . . . . . . . 237 C H5 . 53721 1 80 . 1 . 1 19 19 C H6 H 1 7.940 0.00 . . . . . . . 237 C H6 . 53721 1 81 . 1 . 1 19 19 C C6 C 13 141.383 0.01 . . . . . . . 237 C C6 . 53721 1 82 . 1 . 1 20 20 A H1' H 1 5.908 0.00 . . . . . . . 238 A H1' . 53721 1 83 . 1 . 1 20 20 A H2 H 1 7.907 0.00 . . . . . . . 238 A H2 . 53721 1 84 . 1 . 1 20 20 A H8 H 1 8.387 0.00 . . . . . . . 238 A H8 . 53721 1 85 . 1 . 1 20 20 A C2 C 13 154.761 0.00 . . . . . . . 238 A C2 . 53721 1 86 . 1 . 1 20 20 A C8 C 13 140.327 0.00 . . . . . . . 238 A C8 . 53721 1 87 . 1 . 1 21 21 A H1' H 1 5.614 0.00 . . . . . . . 239 A H1' . 53721 1 88 . 1 . 1 21 21 A H2 H 1 8.196 0.00 . . . . . . . 239 A H2 . 53721 1 89 . 1 . 1 21 21 A H8 H 1 8.090 0.00 . . . . . . . 239 A H8 . 53721 1 90 . 1 . 1 21 21 A C2 C 13 155.366 0.00 . . . . . . . 239 A C2 . 53721 1 91 . 1 . 1 21 21 A C8 C 13 139.526 0.00 . . . . . . . 239 A C8 . 53721 1 92 . 1 . 1 22 22 G H8 H 1 7.412 0.00 . . . . . . . 240 G H8 . 53721 1 93 . 1 . 1 22 22 G C8 C 13 138.012 0.00 . . . . . . . 240 G C8 . 53721 1 94 . 1 . 1 23 23 G H1' H 1 5.846 0.00 . . . . . . . 241 G H1' . 53721 1 95 . 1 . 1 23 23 G H8 H 1 7.173 0.00 . . . . . . . 241 G H8 . 53721 1 96 . 1 . 1 23 23 G C8 C 13 136.363 0.00 . . . . . . . 241 G C8 . 53721 1 97 . 1 . 1 24 24 U H1' H 1 5.649 0.00 . . . . . . . 242 U H1' . 53721 1 98 . 1 . 1 24 24 U H5 H 1 5.360 0.00 . . . . . . . 242 U H5 . 53721 1 99 . 1 . 1 24 24 U H6 H 1 7.531 0.00 . . . . . . . 242 U H6 . 53721 1 100 . 1 . 1 24 24 U C6 C 13 140.454 0.00 . . . . . . . 242 U C6 . 53721 1 101 . 1 . 1 25 25 C H5 H 1 5.666 0.00 . . . . . . . 243 C H5 . 53721 1 102 . 1 . 1 25 25 C H6 H 1 7.848 0.00 . . . . . . . 243 C H6 . 53721 1 103 . 1 . 1 25 25 C C6 C 13 142.090 0.00 . . . . . . . 243 C C6 . 53721 1 104 . 1 . 1 26 26 C H1' H 1 5.716 0.00 . . . . . . . 244 C H1' . 53721 1 105 . 1 . 1 26 26 C H5 H 1 5.673 0.00 . . . . . . . 244 C H5 . 53721 1 106 . 1 . 1 26 26 C H6 H 1 7.752 0.00 . . . . . . . 244 C H6 . 53721 1 107 . 1 . 1 26 26 C C6 C 13 142.044 0.00 . . . . . . . 244 C C6 . 53721 1 108 . 1 . 1 27 27 A H1' H 1 5.794 0.00 . . . . . . . 245 A H1' . 53721 1 109 . 1 . 1 27 27 A H2 H 1 7.608 0.00 . . . . . . . 245 A H2 . 53721 1 110 . 1 . 1 27 27 A H8 H 1 8.032 0.00 . . . . . . . 245 A H8 . 53721 1 111 . 1 . 1 27 27 A C2 C 13 153.749 0.00 . . . . . . . 245 A C2 . 53721 1 112 . 1 . 1 27 27 A C8 C 13 140.278 0.00 . . . . . . . 245 A C8 . 53721 1 113 . 1 . 1 28 28 U H1' H 1 5.567 0.00 . . . . . . . 246 U H1' . 53721 1 114 . 1 . 1 28 28 U H5 H 1 5.456 0.00 . . . . . . . 246 U H5 . 53721 1 115 . 1 . 1 28 28 U H6 H 1 7.529 0.00 . . . . . . . 246 U H6 . 53721 1 116 . 1 . 1 28 28 U C6 C 13 141.120 0.00 . . . . . . . 246 U C6 . 53721 1 117 . 1 . 1 29 29 U H1' H 1 5.589 0.00 . . . . . . . 247 U H1' . 53721 1 118 . 1 . 1 29 29 U H3 H 1 13.681 0.00 . . . . . . . 247 U H3 . 53721 1 119 . 1 . 1 29 29 U H5 H 1 5.559 0.00 . . . . . . . 247 U H5 . 53721 1 120 . 1 . 1 29 29 U H6 H 1 7.939 0.00 . . . . . . . 247 U H6 . 53721 1 121 . 1 . 1 29 29 U C6 C 13 142.586 0.00 . . . . . . . 247 U C6 . 53721 1 122 . 1 . 1 29 29 U N3 N 15 162.682 0.00 . . . . . . . 247 U N3 . 53721 1 123 . 1 . 1 30 30 U H1' H 1 5.567 0.00 . . . . . . . 248 U H1' . 53721 1 124 . 1 . 1 30 30 U H3 H 1 13.188 0.00 . . . . . . . 248 U H3 . 53721 1 125 . 1 . 1 30 30 U H5 H 1 5.559 0.00 . . . . . . . 248 U H5 . 53721 1 126 . 1 . 1 30 30 U H6 H 1 7.931 0.00 . . . . . . . 248 U H6 . 53721 1 127 . 1 . 1 30 30 U C6 C 13 141.969 0.00 . . . . . . . 248 U C6 . 53721 1 128 . 1 . 1 30 30 U N3 N 15 162.161 0.00 . . . . . . . 248 U N3 . 53721 1 129 . 1 . 1 31 31 G H1 H 1 12.382 0.00 . . . . . . . 249 G H1 . 53721 1 130 . 1 . 1 31 31 G H1' H 1 5.692 0.00 . . . . . . . 249 G H1' . 53721 1 131 . 1 . 1 31 31 G H8 H 1 7.685 0.00 . . . . . . . 249 G H8 . 53721 1 132 . 1 . 1 31 31 G C8 C 13 136.673 0.00 . . . . . . . 249 G C8 . 53721 1 133 . 1 . 1 31 31 G N1 N 15 147.372 0.00 . . . . . . . 249 G N1 . 53721 1 134 . 1 . 1 32 32 U H1' H 1 5.530 0.01 . . . . . . . 250 U H1' . 53721 1 135 . 1 . 1 32 32 U H5 H 1 4.897 0.00 . . . . . . . 250 U H5 . 53721 1 136 . 1 . 1 32 32 U H6 H 1 7.487 0.00 . . . . . . . 250 U H6 . 53721 1 137 . 1 . 1 32 32 U C6 C 13 140.805 0.00 . . . . . . . 250 U C6 . 53721 1 138 . 1 . 1 33 33 A H1' H 1 5.995 0.00 . . . . . . . 251 A H1' . 53721 1 139 . 1 . 1 33 33 A H2 H 1 7.284 0.00 . . . . . . . 251 A H2 . 53721 1 140 . 1 . 1 33 33 A H8 H 1 7.979 0.00 . . . . . . . 251 A H8 . 53721 1 141 . 1 . 1 33 33 A C2 C 13 153.520 0.00 . . . . . . . 251 A C2 . 53721 1 142 . 1 . 1 33 33 A C8 C 13 138.865 0.00 . . . . . . . 251 A C8 . 53721 1 143 . 1 . 1 34 34 G H1 H 1 12.977 0.00 . . . . . . . 252 G H1 . 53721 1 144 . 1 . 1 34 34 G H1' H 1 5.632 0.00 . . . . . . . 252 G H1' . 53721 1 145 . 1 . 1 34 34 G H8 H 1 7.243 0.00 . . . . . . . 252 G H8 . 53721 1 146 . 1 . 1 34 34 G C8 C 13 135.690 0.00 . . . . . . . 252 G C8 . 53721 1 147 . 1 . 1 34 34 G N1 N 15 147.301 0.00 . . . . . . . 252 G N1 . 53721 1 148 . 1 . 1 35 35 G H1 H 1 13.373 0.00 . . . . . . . 253 G H1 . 53721 1 149 . 1 . 1 35 35 G H1' H 1 5.715 0.00 . . . . . . . 253 G H1' . 53721 1 150 . 1 . 1 35 35 G H8 H 1 7.272 0.00 . . . . . . . 253 G H8 . 53721 1 151 . 1 . 1 35 35 G C8 C 13 135.885 0.00 . . . . . . . 253 G C8 . 53721 1 152 . 1 . 1 35 35 G N1 N 15 148.743 0.00 . . . . . . . 253 G N1 . 53721 1 153 . 1 . 1 36 36 C H1' H 1 5.856 0.00 . . . . . . . 254 C H1' . 53721 1 154 . 1 . 1 36 36 C H5 H 1 5.216 0.00 . . . . . . . 254 C H5 . 53721 1 155 . 1 . 1 36 36 C H6 H 1 7.608 0.00 . . . . . . . 254 C H6 . 53721 1 156 . 1 . 1 36 36 C H41 H 1 8.586 0.00 . . . . . . . 254 C H41 . 53721 1 157 . 1 . 1 36 36 C H42 H 1 6.857 0.00 . . . . . . . 254 C H42 . 53721 1 158 . 1 . 1 36 36 C C6 C 13 140.812 0.00 . . . . . . . 254 C C6 . 53721 1 159 . 1 . 1 37 37 C H5 H 1 5.559 0.00 . . . . . . . 255 C H5 . 53721 1 160 . 1 . 1 37 37 C H6 H 1 7.655 0.00 . . . . . . . 255 C H6 . 53721 1 161 . 1 . 1 37 37 C H41 H 1 8.396 0.00 . . . . . . . 255 C H41 . 53721 1 162 . 1 . 1 37 37 C H42 H 1 7.010 0.00 . . . . . . . 255 C H42 . 53721 1 163 . 1 . 1 37 37 C C6 C 13 141.548 0.01 . . . . . . . 255 C C6 . 53721 1 stop_ save_ save_assigned_chemical_shifts_2 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_2 _Assigned_chem_shift_list.Entry_ID 53721 _Assigned_chem_shift_list.ID 2 _Assigned_chem_shift_list.Name '7SK SL3e-top RNA + Mg' _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 2 '2D 1H-1H NOESY' . . . 53721 2 3 '2D 1H-13C HSQC' . . . 53721 2 4 '2D 1H-15N HSQC' . . . 53721 2 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 1 $software_1 . . 53721 2 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 4.893 0.00 . . . . . . . 219 G H1' . 53721 2 2 . 1 . 1 1 1 G H8 H 1 8.167 0.00 . . . . . . . 219 G H8 . 53721 2 3 . 1 . 1 1 1 G C8 C 13 139.636 0.00 . . . . . . . 219 G C8 . 53721 2 4 . 1 . 1 2 2 G H1 H 1 13.432 0.00 . . . . . . . 220 G H1 . 53721 2 5 . 1 . 1 2 2 G H1' H 1 5.780 0.00 . . . . . . . 220 G H1' . 53721 2 6 . 1 . 1 2 2 G H8 H 1 7.718 0.00 . . . . . . . 220 G H8 . 53721 2 7 . 1 . 1 2 2 G C8 C 13 136.998 0.00 . . . . . . . 220 G C8 . 53721 2 8 . 1 . 1 2 2 G N1 N 15 148.744 0.00 . . . . . . . 220 G N1 . 53721 2 9 . 1 . 1 3 3 C H1' H 1 5.552 0.00 . . . . . . . 221 C H1' . 53721 2 10 . 1 . 1 3 3 C H5 H 1 5.271 0.00 . . . . . . . 221 C H5 . 53721 2 11 . 1 . 1 3 3 C H6 H 1 7.733 0.00 . . . . . . . 221 C H6 . 53721 2 12 . 1 . 1 3 3 C H41 H 1 8.644 0.00 . . . . . . . 221 C H41 . 53721 2 13 . 1 . 1 3 3 C H42 H 1 6.728 0.00 . . . . . . . 221 C H42 . 53721 2 14 . 1 . 1 3 3 C C6 C 13 141.092 0.00 . . . . . . . 221 C C6 . 53721 2 15 . 1 . 1 4 4 C H5 H 1 5.524 0.00 . . . . . . . 222 C H5 . 53721 2 16 . 1 . 1 4 4 C H6 H 1 7.784 0.00 . . . . . . . 222 C H6 . 53721 2 17 . 1 . 1 4 4 C H41 H 1 8.485 0.00 . . . . . . . 222 C H41 . 53721 2 18 . 1 . 1 4 4 C H42 H 1 6.794 0.00 . . . . . . . 222 C H42 . 53721 2 19 . 1 . 1 4 4 C C6 C 13 141.386 0.00 . . . . . . . 222 C C6 . 53721 2 20 . 1 . 1 5 5 U H1' H 1 5.515 0.00 . . . . . . . 223 U H1' . 53721 2 21 . 1 . 1 5 5 U H5 H 1 5.384 0.00 . . . . . . . 223 U H5 . 53721 2 22 . 1 . 1 5 5 U H6 H 1 7.842 0.08 . . . . . . . 223 U H6 . 53721 2 23 . 1 . 1 5 5 U C6 C 13 142.355 0.00 . . . . . . . 223 U C6 . 53721 2 24 . 1 . 1 6 6 C H1' H 1 5.515 0.00 . . . . . . . 224 C H1' . 53721 2 25 . 1 . 1 6 6 C H5 H 1 5.511 0.00 . . . . . . . 224 C H5 . 53721 2 26 . 1 . 1 6 6 C H6 H 1 7.717 0.09 . . . . . . . 224 C H6 . 53721 2 27 . 1 . 1 6 6 C C6 C 13 141.602 0.03 . . . . . . . 224 C C6 . 53721 2 28 . 1 . 1 7 7 C H1' H 1 5.447 0.00 . . . . . . . 225 C H1' . 53721 2 29 . 1 . 1 7 7 C H5 H 1 5.669 0.00 . . . . . . . 225 C H5 . 53721 2 30 . 1 . 1 7 7 C H6 H 1 7.809 0.00 . . . . . . . 225 C H6 . 53721 2 31 . 1 . 1 7 7 C H41 H 1 8.136 0.00 . . . . . . . 225 C H41 . 53721 2 32 . 1 . 1 7 7 C H42 H 1 6.933 0.00 . . . . . . . 225 C H42 . 53721 2 33 . 1 . 1 7 7 C C6 C 13 140.743 0.01 . . . . . . . 225 C C6 . 53721 2 34 . 1 . 1 8 8 A H1' H 1 5.814 0.00 . . . . . . . 226 A H1' . 53721 2 35 . 1 . 1 8 8 A H2 H 1 6.713 0.00 . . . . . . . 226 A H2 . 53721 2 36 . 1 . 1 8 8 A H8 H 1 7.998 0.00 . . . . . . . 226 A H8 . 53721 2 37 . 1 . 1 8 8 A C2 C 13 152.241 0.00 . . . . . . . 226 A C2 . 53721 2 38 . 1 . 1 8 8 A C8 C 13 139.655 0.00 . . . . . . . 226 A C8 . 53721 2 39 . 1 . 1 9 9 A H1' H 1 5.750 0.00 . . . . . . . 227 A H1' . 53721 2 40 . 1 . 1 9 9 A H2 H 1 7.214 0.00 . . . . . . . 227 A H2 . 53721 2 41 . 1 . 1 9 9 A H8 H 1 7.647 0.00 . . . . . . . 227 A H8 . 53721 2 42 . 1 . 1 9 9 A C2 C 13 152.991 0.00 . . . . . . . 227 A C2 . 53721 2 43 . 1 . 1 9 9 A C8 C 13 139.164 0.00 . . . . . . . 227 A C8 . 53721 2 44 . 1 . 1 10 10 A H1' H 1 5.745 0.00 . . . . . . . 228 A H1' . 53721 2 45 . 1 . 1 10 10 A H2 H 1 7.760 0.00 . . . . . . . 228 A H2 . 53721 2 46 . 1 . 1 10 10 A H8 H 1 7.469 0.00 . . . . . . . 228 A H8 . 53721 2 47 . 1 . 1 10 10 A C2 C 13 154.314 0.00 . . . . . . . 228 A C2 . 53721 2 48 . 1 . 1 10 10 A C8 C 13 138.913 0.00 . . . . . . . 228 A C8 . 53721 2 49 . 1 . 1 11 11 C H1' H 1 5.244 0.00 . . . . . . . 229 C H1' . 53721 2 50 . 1 . 1 11 11 C H5 H 1 5.412 0.00 . . . . . . . 229 C H5 . 53721 2 51 . 1 . 1 11 11 C H6 H 1 7.390 0.00 . . . . . . . 229 C H6 . 53721 2 52 . 1 . 1 11 11 C C6 C 13 141.260 0.00 . . . . . . . 229 C C6 . 53721 2 53 . 1 . 1 12 12 A H1' H 1 5.837 0.00 . . . . . . . 230 A H1' . 53721 2 54 . 1 . 1 12 12 A H2 H 1 7.635 0.00 . . . . . . . 230 A H2 . 53721 2 55 . 1 . 1 12 12 A H8 H 1 8.017 0.00 . . . . . . . 230 A H8 . 53721 2 56 . 1 . 1 12 12 A C2 C 13 154.235 0.00 . . . . . . . 230 A C2 . 53721 2 57 . 1 . 1 12 12 A C8 C 13 140.601 0.00 . . . . . . . 230 A C8 . 53721 2 58 . 1 . 1 13 13 A H1' H 1 5.611 0.00 . . . . . . . 231 A H1' . 53721 2 59 . 1 . 1 13 13 A H2 H 1 7.920 0.00 . . . . . . . 231 A H2 . 53721 2 60 . 1 . 1 13 13 A H8 H 1 7.785 0.00 . . . . . . . 231 A H8 . 53721 2 61 . 1 . 1 13 13 A C2 C 13 154.672 0.00 . . . . . . . 231 A C2 . 53721 2 62 . 1 . 1 13 13 A C8 C 13 139.434 0.00 . . . . . . . 231 A C8 . 53721 2 63 . 1 . 1 14 14 G H1' H 1 5.199 0.00 . . . . . . . 232 G H1' . 53721 2 64 . 1 . 1 14 14 G H8 H 1 7.161 0.00 . . . . . . . 232 G H8 . 53721 2 65 . 1 . 1 14 14 G C8 C 13 136.513 0.00 . . . . . . . 232 G C8 . 53721 2 66 . 1 . 1 15 15 C H1' H 1 5.498 0.00 . . . . . . . 233 C H1' . 53721 2 67 . 1 . 1 15 15 C H5 H 1 5.302 0.00 . . . . . . . 233 C H5 . 53721 2 68 . 1 . 1 15 15 C H6 H 1 7.522 0.00 . . . . . . . 233 C H6 . 53721 2 69 . 1 . 1 15 15 C C6 C 13 140.772 0.01 . . . . . . . 233 C C6 . 53721 2 70 . 1 . 1 16 16 U H1' H 1 5.880 0.00 . . . . . . . 234 U H1' . 53721 2 71 . 1 . 1 16 16 U H5 H 1 5.658 0.00 . . . . . . . 234 U H5 . 53721 2 72 . 1 . 1 16 16 U H6 H 1 7.663 0.00 . . . . . . . 234 U H6 . 53721 2 73 . 1 . 1 16 16 U C6 C 13 140.971 0.00 . . . . . . . 234 U C6 . 53721 2 74 . 1 . 1 17 17 C H5 H 1 5.575 0.00 . . . . . . . 235 C H5 . 53721 2 75 . 1 . 1 17 17 C H6 H 1 7.542 0.00 . . . . . . . 235 C H6 . 53721 2 76 . 1 . 1 17 17 C C6 C 13 142.365 0.01 . . . . . . . 235 C C6 . 53721 2 77 . 1 . 1 18 18 U H5 H 1 5.700 0.00 . . . . . . . 236 U H5 . 53721 2 78 . 1 . 1 18 18 U H6 H 1 7.778 0.00 . . . . . . . 236 U H6 . 53721 2 79 . 1 . 1 18 18 U C6 C 13 143.455 0.00 . . . . . . . 236 U C6 . 53721 2 80 . 1 . 1 19 19 C H5 H 1 5.877 0.00 . . . . . . . 237 C H5 . 53721 2 81 . 1 . 1 19 19 C H6 H 1 7.907 0.00 . . . . . . . 237 C H6 . 53721 2 82 . 1 . 1 19 19 C C6 C 13 141.981 0.03 . . . . . . . 237 C C6 . 53721 2 83 . 1 . 1 20 20 A H1' H 1 5.876 0.00 . . . . . . . 238 A H1' . 53721 2 84 . 1 . 1 20 20 A H2 H 1 7.918 0.00 . . . . . . . 238 A H2 . 53721 2 85 . 1 . 1 20 20 A H8 H 1 8.318 0.00 . . . . . . . 238 A H8 . 53721 2 86 . 1 . 1 20 20 A C2 C 13 154.912 0.00 . . . . . . . 238 A C2 . 53721 2 87 . 1 . 1 20 20 A C8 C 13 140.804 0.00 . . . . . . . 238 A C8 . 53721 2 88 . 1 . 1 21 21 A H1' H 1 5.681 0.00 . . . . . . . 239 A H1' . 53721 2 89 . 1 . 1 21 21 A H2 H 1 8.138 0.00 . . . . . . . 239 A H2 . 53721 2 90 . 1 . 1 21 21 A H8 H 1 8.112 0.00 . . . . . . . 239 A H8 . 53721 2 91 . 1 . 1 21 21 A C2 C 13 155.330 0.00 . . . . . . . 239 A C2 . 53721 2 92 . 1 . 1 21 21 A C8 C 13 140.098 0.00 . . . . . . . 239 A C8 . 53721 2 93 . 1 . 1 22 22 G H8 H 1 7.474 0.00 . . . . . . . 240 G H8 . 53721 2 94 . 1 . 1 22 22 G C8 C 13 138.013 0.00 . . . . . . . 240 G C8 . 53721 2 95 . 1 . 1 23 23 G H1' H 1 5.796 0.00 . . . . . . . 241 G H1' . 53721 2 96 . 1 . 1 23 23 G H8 H 1 7.247 0.00 . . . . . . . 241 G H8 . 53721 2 97 . 1 . 1 23 23 G C8 C 13 136.677 0.00 . . . . . . . 241 G C8 . 53721 2 98 . 1 . 1 24 24 U H5 H 1 5.371 0.00 . . . . . . . 242 U H5 . 53721 2 99 . 1 . 1 24 24 U H6 H 1 7.553 0.00 . . . . . . . 242 U H6 . 53721 2 100 . 1 . 1 24 24 U C6 C 13 140.865 0.00 . . . . . . . 242 U C6 . 53721 2 101 . 1 . 1 25 25 C H5 H 1 5.662 0.00 . . . . . . . 243 C H5 . 53721 2 102 . 1 . 1 25 25 C H6 H 1 7.815 0.01 . . . . . . . 243 C H6 . 53721 2 103 . 1 . 1 25 25 C C6 C 13 142.293 0.00 . . . . . . . 243 C C6 . 53721 2 104 . 1 . 1 26 26 C H1' H 1 5.710 0.00 . . . . . . . 244 C H1' . 53721 2 105 . 1 . 1 26 26 C H5 H 1 5.684 0.00 . . . . . . . 244 C H5 . 53721 2 106 . 1 . 1 26 26 C H6 H 1 7.734 0.00 . . . . . . . 244 C H6 . 53721 2 107 . 1 . 1 26 26 C C6 C 13 142.197 0.01 . . . . . . . 244 C C6 . 53721 2 108 . 1 . 1 27 27 A H1' H 1 5.805 0.00 . . . . . . . 245 A H1' . 53721 2 109 . 1 . 1 27 27 A H2 H 1 7.684 0.00 . . . . . . . 245 A H2 . 53721 2 110 . 1 . 1 27 27 A H8 H 1 8.046 0.00 . . . . . . . 245 A H8 . 53721 2 111 . 1 . 1 27 27 A C2 C 13 154.171 0.00 . . . . . . . 245 A C2 . 53721 2 112 . 1 . 1 27 27 A C8 C 13 140.451 0.00 . . . . . . . 245 A C8 . 53721 2 113 . 1 . 1 28 28 U H1' H 1 4.935 0.00 . . . . . . . 246 U H1' . 53721 2 114 . 1 . 1 28 28 U H5 H 1 5.472 0.00 . . . . . . . 246 U H5 . 53721 2 115 . 1 . 1 28 28 U H6 H 1 7.561 0.00 . . . . . . . 246 U H6 . 53721 2 116 . 1 . 1 28 28 U C6 C 13 141.421 0.00 . . . . . . . 246 U C6 . 53721 2 117 . 1 . 1 29 29 U H1' H 1 5.602 0.00 . . . . . . . 247 U H1' . 53721 2 118 . 1 . 1 29 29 U H5 H 1 5.585 0.00 . . . . . . . 247 U H5 . 53721 2 119 . 1 . 1 29 29 U H6 H 1 7.941 0.00 . . . . . . . 247 U H6 . 53721 2 120 . 1 . 1 29 29 U C6 C 13 142.662 0.00 . . . . . . . 247 U C6 . 53721 2 121 . 1 . 1 30 30 U H1' H 1 5.577 0.00 . . . . . . . 248 U H1' . 53721 2 122 . 1 . 1 30 30 U H5 H 1 5.556 0.00 . . . . . . . 248 U H5 . 53721 2 123 . 1 . 1 30 30 U H6 H 1 7.927 0.01 . . . . . . . 248 U H6 . 53721 2 124 . 1 . 1 30 30 U C6 C 13 142.019 0.00 . . . . . . . 248 U C6 . 53721 2 125 . 1 . 1 31 31 G H1 H 1 12.374 0.00 . . . . . . . 249 G H1 . 53721 2 126 . 1 . 1 31 31 G H1' H 1 5.695 0.00 . . . . . . . 249 G H1' . 53721 2 127 . 1 . 1 31 31 G H8 H 1 7.690 0.00 . . . . . . . 249 G H8 . 53721 2 128 . 1 . 1 31 31 G C8 C 13 136.773 0.00 . . . . . . . 249 G C8 . 53721 2 129 . 1 . 1 31 31 G N1 N 15 147.481 0.00 . . . . . . . 249 G N1 . 53721 2 130 . 1 . 1 32 32 U H1' H 1 5.534 0.00 . . . . . . . 250 U H1' . 53721 2 131 . 1 . 1 32 32 U H5 H 1 4.907 0.00 . . . . . . . 250 U H5 . 53721 2 132 . 1 . 1 32 32 U H6 H 1 7.490 0.00 . . . . . . . 250 U H6 . 53721 2 133 . 1 . 1 32 32 U C6 C 13 140.866 0.00 . . . . . . . 250 U C6 . 53721 2 134 . 1 . 1 33 33 A H1' H 1 5.992 0.00 . . . . . . . 251 A H1' . 53721 2 135 . 1 . 1 33 33 A H2 H 1 7.306 0.00 . . . . . . . 251 A H2 . 53721 2 136 . 1 . 1 33 33 A H8 H 1 7.986 0.00 . . . . . . . 251 A H8 . 53721 2 137 . 1 . 1 33 33 A C2 C 13 153.552 0.00 . . . . . . . 251 A C2 . 53721 2 138 . 1 . 1 33 33 A C8 C 13 139.032 0.00 . . . . . . . 251 A C8 . 53721 2 139 . 1 . 1 34 34 G H1 H 1 12.942 0.00 . . . . . . . 252 G H1 . 53721 2 140 . 1 . 1 34 34 G H1' H 1 5.635 0.00 . . . . . . . 252 G H1' . 53721 2 141 . 1 . 1 34 34 G H8 H 1 7.250 0.00 . . . . . . . 252 G H8 . 53721 2 142 . 1 . 1 34 34 G C8 C 13 135.795 0.00 . . . . . . . 252 G C8 . 53721 2 143 . 1 . 1 34 34 G N1 N 15 147.370 0.00 . . . . . . . 252 G N1 . 53721 2 144 . 1 . 1 35 35 G H1 H 1 13.335 0.00 . . . . . . . 253 G H1 . 53721 2 145 . 1 . 1 35 35 G H1' H 1 5.710 0.00 . . . . . . . 253 G H1' . 53721 2 146 . 1 . 1 35 35 G H8 H 1 7.261 0.00 . . . . . . . 253 G H8 . 53721 2 147 . 1 . 1 35 35 G C8 C 13 135.939 0.00 . . . . . . . 253 G C8 . 53721 2 148 . 1 . 1 35 35 G N1 N 15 148.786 0.00 . . . . . . . 253 G N1 . 53721 2 149 . 1 . 1 36 36 C H1' H 1 5.532 0.00 . . . . . . . 254 C H1' . 53721 2 150 . 1 . 1 36 36 C H5 H 1 5.221 0.00 . . . . . . . 254 C H5 . 53721 2 151 . 1 . 1 36 36 C H6 H 1 7.605 0.00 . . . . . . . 254 C H6 . 53721 2 152 . 1 . 1 36 36 C H41 H 1 8.560 0.00 . . . . . . . 254 C H41 . 53721 2 153 . 1 . 1 36 36 C H42 H 1 6.787 0.00 . . . . . . . 254 C H42 . 53721 2 154 . 1 . 1 36 36 C C6 C 13 140.951 0.00 . . . . . . . 254 C C6 . 53721 2 155 . 1 . 1 37 37 C H5 H 1 5.539 0.00 . . . . . . . 255 C H5 . 53721 2 156 . 1 . 1 37 37 C H6 H 1 7.671 0.00 . . . . . . . 255 C H6 . 53721 2 157 . 1 . 1 37 37 C H42 H 1 6.931 0.00 . . . . . . . 255 C H42 . 53721 2 158 . 1 . 1 37 37 C C6 C 13 141.725 0.01 . . . . . . . 255 C C6 . 53721 2 stop_ save_