Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR53244
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
All files associated with the entry
Citation: Kumar, Ajit; Penumutchu, Srinivas; Panchariya, Love; Kumari, Priyanka; Thakur, Shubham; Daripa, Purba; Singh, Vandana; Arulandu, Arockiasamy; Maiti, Souvik; Deshmukh, Mandar; Jain, Niyati. "Loop of Fate: Structural and Mechanistic Insights into hnRNPA1 Binding to the Hepatitis C Virus RNA
" RNA 32, 215-236 (2026).
PubMed: 41285614
Assembly members:
entity_1, polymer, 26 residues, Formula weight is not available
Natural source: Common Name: Hepatitis C Virus Taxonomy ID: 3052230 Superkingdom: Viruses Kingdom: not available Genus/species: Hepacivirus hominis
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGAGACAUAUAUCACAGCCU
GUCUCC
| Data type | Count |
| 13C chemical shifts | 71 |
| 15N chemical shifts | 7 |
| 1H chemical shifts | 184 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | 5BSL3.2 Apical stem loop | 1 |
Entity 1, 5BSL3.2 Apical stem loop 26 residues - Formula weight is not available
| 1 | G | G | A | G | A | C | A | U | A | U | ||||
| 2 | A | U | C | A | C | A | G | C | C | U | ||||
| 3 | G | U | C | U | C | C |
sample_1: 5BSL3.2 Apical stem loop, [rRTPs (3',4',5',5''), and rYTPs (5,3',4',5',5'')], 200 uM
sample_conditions_1: ionic strength: 5 mM; pH: 6.5; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| TOCSY | sample_1 | isotropic | sample_conditions_1 |
| HMQC | sample_1 | isotropic | sample_conditions_1 |
| HSQC | sample_1 | isotropic | sample_conditions_1 |
topspin4, NMRPipe/nmrdraw,NMRViewJ, XplorNIH 2.25 - chemical shift assignment, collection, structure solution