Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5007
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Flinders, J.; Dieckmann, T.. "A pH Controlled Conformational Switch In the Cleavage Site of the VS Ribozyme
Substrate RNA
" J. Mol. Biol. 308, 665-679 (2001).
PubMed: 11350168
Assembly members:
VS Ribozyme, polymer, 30 residues, 9900 Da.
Natural source: Common Name: Neurospora crassa Taxonomy ID: 5141 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Neurospora crassa
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
VS Ribozyme: GGUGCGAAGGGCGUCGUCGC
CCCGAGCGCC
| Data type | Count |
| 13C chemical shifts | 107 |
| 15N chemical shifts | 16 |
| 1H chemical shifts | 177 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | VS RIBOZYME SUBSTRATE RNA | 1 |
Entity 1, VS RIBOZYME SUBSTRATE RNA 30 residues - 9900 Da.
| 1 | G | G | U | G | C | G | A | A | G | G | |
| 2 | G | C | G | U | C | G | U | C | G | C | |
| 3 | C | C | C | G | A | G | C | G | C | C |
sample_1: VS Ribozyme 1.5 mM
sample_2: VS Ribozyme, [U-98% 13C; U-98% 15N], 1.0 mM
sample_3: VS Ribozyme, [98%-13C; 98%-15N]-Ade, 1.0 mM
sample_cond_1: ionic strength: 5 mM; pH: 6.0; pressure: 1 atm; temperature: 274 K
sample_cond_2: ionic strength: 5 mM; pH*: 6.0; pressure: 1 atm; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | not available | not available | not available |
| 2D 1H-13C HSQC | not available | not available | not available |
| 2D 1H-13C CT-HSQC | not available | not available | not available |
| 2D 1H-15N HMQC | not available | not available | not available |
| 2D 1H-1H DQF-COSY | not available | not available | not available |
| 3D 13C-1H-1H NOESY | not available | not available | not available |
| 3D 1H-13C-1H HCCH-COSY | not available | not available | not available |
xwinnmr v2.6 - collection, processing
XEASY v1.3.13 - data analysis
CNS v1.0 - structure solution