data_5007 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 5007 _Entry.Title ; SOLUTION STRUCTURE OF THE VS RIBOZYME SUBSTRATE STEM-LOOP ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2001-05-07 _Entry.Accession_date 2001-05-07 _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 2.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 J. Flinders . C. . 5007 2 T. Dieckmann . . . 5007 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 5007 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 107 5007 '15N chemical shifts' 16 5007 '1H chemical shifts' 177 5007 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 2 . . 2001-06-07 . original author 'Original release' 5007 1 . . 2003-07-01 . update BMRB 'Links to related BMRB entries inserted' 5007 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 5852 'A mimic of the VS Ribozyme Hairpin Substrate' 5007 PDB 1HWQ 'BMRB Entry Tracking System' 5007 PDB 1J6Q 'BMRB Entry Tracking System' 5007 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 5007 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.DOI . _Citation.PubMed_ID 11350168 _Citation.Full_citation . _Citation.Title ; A pH Controlled Conformational Switch In the Cleavage Site of the VS Ribozyme Substrate RNA ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'J. Mol. Biol.' _Citation.Journal_name_full 'Journal of Molecular Biology' _Citation.Journal_volume 308 _Citation.Journal_issue 4 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 665 _Citation.Page_last 679 _Citation.Year 2001 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 J. Flinders . C. . 5007 1 2 T. Dieckmann . . . 5007 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID 'A+C BASE PAIR' 5007 1 'PROTONATED ADENINE' 5007 1 STEM-LOOP 5007 1 'TANDEM GA' 5007 1 'VS RIBOZYME' 5007 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_system_VS_Loop_I _Assembly.Sf_category assembly _Assembly.Sf_framecode system_VS_Loop_I _Assembly.Entry_ID 5007 _Assembly.ID 1 _Assembly.Name 'VS RIBOZYME SUBSTRATE STEM-LOOP' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Assembly_type.Type _Assembly_type.Entry_ID _Assembly_type.Assembly_ID monomer 5007 1 stop_ loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'VS RIBOZYME SUBSTRATE RNA' 1 $VS_RNA . . . native . . . . . 5007 1 stop_ loop_ _Assembly_db_link.Author_supplied _Assembly_db_link.Database_code _Assembly_db_link.Accession_code _Assembly_db_link.Entry_mol_code _Assembly_db_link.Entry_mol_name _Assembly_db_link.Entry_experimental_method _Assembly_db_link.Entry_structure_resolution _Assembly_db_link.Entry_relation_type _Assembly_db_link.Entry_details _Assembly_db_link.Entry_ID _Assembly_db_link.Assembly_ID . PDB 1HWQ . . . . . . 5007 1 stop_ loop_ _Assembly_common_name.Name _Assembly_common_name.Type _Assembly_common_name.Entry_ID _Assembly_common_name.Assembly_ID 'VS Loop I' abbreviation 5007 1 'VS RIBOZYME SUBSTRATE STEM-LOOP' system 5007 1 stop_ loop_ _Assembly_bio_function.Biological_function _Assembly_bio_function.Entry_ID _Assembly_bio_function.Assembly_ID 'catalytic RNA molecule' 5007 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_VS_RNA _Entity.Sf_category entity _Entity.Sf_framecode VS_RNA _Entity.Entry_ID 5007 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name 'VS Ribozyme' _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGUGCGAAGGGCGUCGUCGC CCCGAGCGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 30 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic . _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight 9900 _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID 'VS Ribozyme' common 5007 1 'VS RNA' abbreviation 5007 1 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 615 G . 5007 1 2 616 G . 5007 1 3 617 U . 5007 1 4 618 G . 5007 1 5 619 C . 5007 1 6 620 G . 5007 1 7 621 A . 5007 1 8 622 A . 5007 1 9 623 G . 5007 1 10 624 G . 5007 1 11 625 G . 5007 1 12 626 C . 5007 1 13 627 G . 5007 1 14 628 U . 5007 1 15 629 C . 5007 1 16 630 G . 5007 1 17 631 U . 5007 1 18 632 C . 5007 1 19 633 G . 5007 1 20 634 C . 5007 1 21 635 C . 5007 1 22 636 C . 5007 1 23 637 C . 5007 1 24 638 G . 5007 1 25 639 A . 5007 1 26 640 G . 5007 1 27 641 C . 5007 1 28 642 G . 5007 1 29 643 C . 5007 1 30 644 C . 5007 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 5007 1 . G 2 2 5007 1 . U 3 3 5007 1 . G 4 4 5007 1 . C 5 5 5007 1 . G 6 6 5007 1 . A 7 7 5007 1 . A 8 8 5007 1 . G 9 9 5007 1 . G 10 10 5007 1 . G 11 11 5007 1 . C 12 12 5007 1 . G 13 13 5007 1 . U 14 14 5007 1 . C 15 15 5007 1 . G 16 16 5007 1 . U 17 17 5007 1 . C 18 18 5007 1 . G 19 19 5007 1 . C 20 20 5007 1 . C 21 21 5007 1 . C 22 22 5007 1 . C 23 23 5007 1 . G 24 24 5007 1 . A 25 25 5007 1 . G 26 26 5007 1 . C 27 27 5007 1 . G 28 28 5007 1 . C 29 29 5007 1 . C 30 30 5007 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 5007 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $VS_RNA . 5141 . . 'Neurospora crassa' 'Neurospora crassa' . . Eukaryota Fungi Neurospora crassa . . . . . . . . . . . . . . 'Varkud Satellite' . . . . . . 5007 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 5007 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $VS_RNA . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . 'The molecule was synthesized using T7 RNA polymerase and a synthetic DNA template.' . . 5007 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 5007 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'VS Ribozyme' . . . 1 $VS_RNA . . 1.5 . . mM . . . . 5007 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 5007 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'VS Ribozyme' '[U-98% 13C; U-98% 15N]' . . 1 $VS_RNA . . 1.0 . . mM . . . . 5007 2 stop_ save_ save_sample_3 _Sample.Sf_category sample _Sample.Sf_framecode sample_3 _Sample.Entry_ID 5007 _Sample.ID 3 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'VS Ribozyme' '[98%-13C; 98%-15N]-Ade' . . 1 $VS_RNA . . 1.0 . . mM . . . . 5007 3 stop_ save_ ####################### # Sample conditions # ####################### save_sample_cond_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_1 _Sample_condition_list.Entry_ID 5007 _Sample_condition_list.ID 1 _Sample_condition_list.Details 'Sample was in 90% H2O/10% D2O with no added salt or buffer.' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 5 . mM 5007 1 pH 6.0 0.3 n/a 5007 1 pressure 1 . atm 5007 1 temperature 274 0.2 K 5007 1 stop_ save_ save_sample_cond_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_2 _Sample_condition_list.Entry_ID 5007 _Sample_condition_list.ID 2 _Sample_condition_list.Details 'Sample was in 100% D2O with no added salt or buffer.' loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 5 . mM 5007 2 pH* 6.0 0.3 n/a 5007 2 pressure 1 . atm 5007 2 temperature 293 0.2 K 5007 2 stop_ save_ ############################ # Computer software used # ############################ save_XWINNMR _Software.Sf_category software _Software.Sf_framecode XWINNMR _Software.Entry_ID 5007 _Software.ID 1 _Software.Name xwinnmr _Software.Version 2.6 _Software.Details Bruker loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'collection, processing' 5007 1 stop_ save_ save_XEasy _Software.Sf_category software _Software.Sf_framecode XEasy _Software.Entry_ID 5007 _Software.ID 2 _Software.Name XEASY _Software.Version 1.3.13 _Software.Details . loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'data analysis' 5007 2 stop_ save_ save_CNS _Software.Sf_category software _Software.Sf_framecode CNS _Software.Entry_ID 5007 _Software.ID 3 _Software.Name CNS _Software.Version 1.0 _Software.Details . loop_ _Task.Task _Task.Entry_ID _Task.Software_ID 'structure solution' 5007 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer _NMR_spectrometer.Entry_ID 5007 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model DRX _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode spectrometer_list _NMR_spectrometer_list.Entry_ID 5007 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer Bruker DRX . 600 . . . 5007 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 5007 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D 1H-1H NOESY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 2 '2D 1H-13C HSQC' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 3 '2D 1H-13C CT-HSQC' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 4 '2D 1H-15N HMQC' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 5 '2D 1H-1H DQF-COSY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 6 '3D 13C-1H-1H NOESY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 7 '3D 1H-13C-1H HCCH-COSY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5007 1 stop_ save_ save_NMR_spec_expt__0_1 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_1 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 1 _NMR_spec_expt.Name '2D 1H-1H NOESY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_2 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_2 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 2 _NMR_spec_expt.Name '2D 1H-13C HSQC' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_3 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_3 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 3 _NMR_spec_expt.Name '2D 1H-13C CT-HSQC' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_4 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_4 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 4 _NMR_spec_expt.Name '2D 1H-15N HMQC' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_5 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_5 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 5 _NMR_spec_expt.Name '2D 1H-1H DQF-COSY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_6 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_6 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 6 _NMR_spec_expt.Name '3D 13C-1H-1H NOESY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_7 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_7 _NMR_spec_expt.Entry_ID 5007 _NMR_spec_expt.ID 7 _NMR_spec_expt.Name '3D 1H-13C-1H HCCH-COSY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_ref_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_ref_1 _Chem_shift_reference.Entry_ID 5007 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.0 . indirect 0.251449530 . . . . . . . . . 5007 1 H 1 DSS 'methyl protons' . . . . ppm 0.0 internal direct 1.0 . . . . . . . . . 5007 1 N 15 DSS 'methyl protons' . . . . ppm 0.0 . indirect 0.101329118 . . . . . . . . . 5007 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_chemical_shift_set_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chemical_shift_set_1 _Assigned_chem_shift_list.Entry_ID 5007 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_cond_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_ref_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID . . 1 $sample_1 . 5007 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H8 H 1 8.12 0.01 . 1 . . . . . . . . 5007 1 2 . 1 1 1 1 G C8 C 13 136.3 0.1 . 1 . . . . . . . . 5007 1 3 . 1 1 1 1 G N1 N 15 151.3 0.1 . 1 . . . . . . . . 5007 1 4 . 1 1 1 1 G H1' H 1 5.80 0.01 . 1 . . . . . . . . 5007 1 5 . 1 1 1 1 G H2' H 1 4.92 0.01 . 1 . . . . . . . . 5007 1 6 . 1 1 1 1 G H3' H 1 4.67 0.01 . 1 . . . . . . . . 5007 1 7 . 1 1 1 1 G H4' H 1 4.36 0.01 . 1 . . . . . . . . 5007 1 8 . 1 1 1 1 G C1' C 13 89.1 0.1 . 1 . . . . . . . . 5007 1 9 . 1 1 1 1 G C2' C 13 72.3 0.1 . 1 . . . . . . . . 5007 1 10 . 1 1 1 1 G C3' C 13 72.2 0.1 . 1 . . . . . . . . 5007 1 11 . 1 1 2 2 G H1 H 1 13.55 0.01 . 1 . . . . . . . . 5007 1 12 . 1 1 2 2 G H8 H 1 7.52 0.01 . 1 . . . . . . . . 5007 1 13 . 1 1 2 2 G C8 C 13 134.3 0.1 . 1 . . . . . . . . 5007 1 14 . 1 1 2 2 G N1 N 15 152.1 0.1 . 1 . . . . . . . . 5007 1 15 . 1 1 2 2 G H1' H 1 5.92 0.01 . 1 . . . . . . . . 5007 1 16 . 1 1 2 2 G H2' H 1 4.66 0.01 . 1 . . . . . . . . 5007 1 17 . 1 1 2 2 G H3' H 1 4.40 0.01 . 1 . . . . . . . . 5007 1 18 . 1 1 2 2 G C1' C 13 90.9 0.1 . 1 . . . . . . . . 5007 1 19 . 1 1 2 2 G C2' C 13 72.8 0.1 . 1 . . . . . . . . 5007 1 20 . 1 1 2 2 G C3' C 13 70.3 0.1 . 1 . . . . . . . . 5007 1 21 . 1 1 3 3 U H3 H 1 11.73 0.01 . 1 . . . . . . . . 5007 1 22 . 1 1 3 3 U H5 H 1 5.44 0.01 . 1 . . . . . . . . 5007 1 23 . 1 1 3 3 U H6 H 1 7.60 0.01 . 1 . . . . . . . . 5007 1 24 . 1 1 3 3 U N3 N 15 163.0 0.1 . 1 . . . . . . . . 5007 1 25 . 1 1 3 3 U H1' H 1 5.52 0.01 . 1 . . . . . . . . 5007 1 26 . 1 1 3 3 U H2' H 1 4.51 0.01 . 1 . . . . . . . . 5007 1 27 . 1 1 3 3 U C1' C 13 91.3 0.1 . 1 . . . . . . . . 5007 1 28 . 1 1 3 3 U C2' C 13 73.2 0.1 . 1 . . . . . . . . 5007 1 29 . 1 1 4 4 G H1 H 1 12.88 0.01 . 1 . . . . . . . . 5007 1 30 . 1 1 4 4 G H8 H 1 7.84 0.01 . 1 . . . . . . . . 5007 1 31 . 1 1 4 4 G C8 C 13 134.8 0.1 . 1 . . . . . . . . 5007 1 32 . 1 1 4 4 G N1 N 15 151.5 0.1 . 1 . . . . . . . . 5007 1 33 . 1 1 4 4 G H1' H 1 5.73 0.01 . 1 . . . . . . . . 5007 1 34 . 1 1 4 4 G H2' H 1 4.46 0.01 . 1 . . . . . . . . 5007 1 35 . 1 1 4 4 G C1' C 13 90.6 0.1 . 1 . . . . . . . . 5007 1 36 . 1 1 5 5 C H41 H 1 8.14 0.01 . 2 . . . . . . . . 5007 1 37 . 1 1 5 5 C H42 H 1 6.64 0.01 . 2 . . . . . . . . 5007 1 38 . 1 1 5 5 C H5 H 1 4.94 0.01 . 1 . . . . . . . . 5007 1 39 . 1 1 5 5 C H6 H 1 7.18 0.01 . 1 . . . . . . . . 5007 1 40 . 1 1 5 5 C C6 C 13 137.8 0.1 . 1 . . . . . . . . 5007 1 41 . 1 1 5 5 C H1' H 1 5.34 0.01 . 1 . . . . . . . . 5007 1 42 . 1 1 5 5 C H2' H 1 4.42 0.01 . 1 . . . . . . . . 5007 1 43 . 1 1 5 5 C H3' H 1 4.15 0.01 . 1 . . . . . . . . 5007 1 44 . 1 1 5 5 C C1' C 13 92.1 0.1 . 1 . . . . . . . . 5007 1 45 . 1 1 5 5 C C2' C 13 72.5 0.1 . 1 . . . . . . . . 5007 1 46 . 1 1 5 5 C C3' C 13 69.9 0.1 . 1 . . . . . . . . 5007 1 47 . 1 1 6 6 G H1 H 1 9.82 0.01 . 1 . . . . . . . . 5007 1 48 . 1 1 6 6 G H8 H 1 7.93 0.01 . 1 . . . . . . . . 5007 1 49 . 1 1 6 6 G C8 C 13 135.2 0.1 . 1 . . . . . . . . 5007 1 50 . 1 1 6 6 G N1 N 15 148.2 0.1 . 1 . . . . . . . . 5007 1 51 . 1 1 6 6 G H1' H 1 5.61 0.01 . 1 . . . . . . . . 5007 1 52 . 1 1 6 6 G H2' H 1 4.57 0.01 . 1 . . . . . . . . 5007 1 53 . 1 1 6 6 G H3' H 1 4.43 0.01 . 1 . . . . . . . . 5007 1 54 . 1 1 6 6 G H4' H 1 4.14 0.01 . 1 . . . . . . . . 5007 1 55 . 1 1 6 6 G H5' H 1 4.02 0.01 . 2 . . . . . . . . 5007 1 56 . 1 1 6 6 G H5'' H 1 4.48 0.01 . 2 . . . . . . . . 5007 1 57 . 1 1 6 6 G C1' C 13 89.0 0.1 . 1 . . . . . . . . 5007 1 58 . 1 1 6 6 G C2' C 13 73.6 0.1 . 1 . . . . . . . . 5007 1 59 . 1 1 6 6 G C3' C 13 72.5 0.1 . 1 . . . . . . . . 5007 1 60 . 1 1 7 7 A H2 H 1 7.92 0.01 . 1 . . . . . . . . 5007 1 61 . 1 1 7 7 A H8 H 1 7.96 0.01 . 1 . . . . . . . . 5007 1 62 . 1 1 7 7 A C8 C 13 137.7 0.1 . 1 . . . . . . . . 5007 1 63 . 1 1 7 7 A H1' H 1 5.31 0.01 . 1 . . . . . . . . 5007 1 64 . 1 1 7 7 A H2' H 1 4.76 0.01 . 1 . . . . . . . . 5007 1 65 . 1 1 7 7 A H3' H 1 4.36 0.01 . 1 . . . . . . . . 5007 1 66 . 1 1 7 7 A H4' H 1 4.27 0.01 . 1 . . . . . . . . 5007 1 67 . 1 1 7 7 A H5' H 1 4.04 0.01 . 2 . . . . . . . . 5007 1 68 . 1 1 7 7 A C1' C 13 90.7 0.1 . 1 . . . . . . . . 5007 1 69 . 1 1 7 7 A C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 70 . 1 1 7 7 A C4' C 13 79.6 0.1 . 1 . . . . . . . . 5007 1 71 . 1 1 7 7 A C5' C 13 61.4 0.1 . 1 . . . . . . . . 5007 1 72 . 1 1 8 8 A H2 H 1 8.09 0.01 . 1 . . . . . . . . 5007 1 73 . 1 1 8 8 A H8 H 1 7.94 0.01 . 1 . . . . . . . . 5007 1 74 . 1 1 8 8 A C8 C 13 138.5 0.1 . 1 . . . . . . . . 5007 1 75 . 1 1 8 8 A H1' H 1 5.18 0.01 . 1 . . . . . . . . 5007 1 76 . 1 1 8 8 A H2' H 1 4.54 0.01 . 1 . . . . . . . . 5007 1 77 . 1 1 8 8 A H3' H 1 4.42 0.01 . 1 . . . . . . . . 5007 1 78 . 1 1 8 8 A H4' H 1 3.92 0.01 . 1 . . . . . . . . 5007 1 79 . 1 1 8 8 A C1' C 13 84.4 0.1 . 1 . . . . . . . . 5007 1 80 . 1 1 8 8 A C2' C 13 73.3 0.1 . 1 . . . . . . . . 5007 1 81 . 1 1 8 8 A C3' C 13 69.7 0.1 . 1 . . . . . . . . 5007 1 82 . 1 1 8 8 A C4' C 13 82.0 0.1 . 1 . . . . . . . . 5007 1 83 . 1 1 9 9 G H1 H 1 12.51 0.01 . 1 . . . . . . . . 5007 1 84 . 1 1 9 9 G H8 H 1 6.80 0.01 . 1 . . . . . . . . 5007 1 85 . 1 1 9 9 G C8 C 13 133.2 0.1 . 1 . . . . . . . . 5007 1 86 . 1 1 9 9 G N1 N 15 151.5 0.1 . 1 . . . . . . . . 5007 1 87 . 1 1 9 9 G H1' H 1 5.37 0.01 . 1 . . . . . . . . 5007 1 88 . 1 1 9 9 G H2' H 1 4.46 0.01 . 1 . . . . . . . . 5007 1 89 . 1 1 9 9 G H3' H 1 4.27 0.01 . 1 . . . . . . . . 5007 1 90 . 1 1 9 9 G H4' H 1 4.37 0.01 . 1 . . . . . . . . 5007 1 91 . 1 1 9 9 G H5' H 1 3.95 0.01 . 2 . . . . . . . . 5007 1 92 . 1 1 9 9 G C1' C 13 90.6 0.1 . 1 . . . . . . . . 5007 1 93 . 1 1 9 9 G C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 94 . 1 1 9 9 G C3' C 13 70.3 0.1 . 1 . . . . . . . . 5007 1 95 . 1 1 9 9 G C4' C 13 76.0 0.1 . 1 . . . . . . . . 5007 1 96 . 1 1 9 9 G C5' C 13 63.0 0.1 . 1 . . . . . . . . 5007 1 97 . 1 1 10 10 G H1 H 1 12.67 0.01 . 1 . . . . . . . . 5007 1 98 . 1 1 10 10 G H8 H 1 7.11 0.01 . 1 . . . . . . . . 5007 1 99 . 1 1 10 10 G C8 C 13 133.6 0.1 . 1 . . . . . . . . 5007 1 100 . 1 1 10 10 G N1 N 15 151.5 0.1 . 1 . . . . . . . . 5007 1 101 . 1 1 10 10 G H1' H 1 5.75 0.01 . 1 . . . . . . . . 5007 1 102 . 1 1 10 10 G H2' H 1 4.57 0.01 . 1 . . . . . . . . 5007 1 103 . 1 1 10 10 G H3' H 1 3.98 0.01 . 1 . . . . . . . . 5007 1 104 . 1 1 10 10 G H4' H 1 4.35 0.01 . 1 . . . . . . . . 5007 1 105 . 1 1 10 10 G H5' H 1 3.99 0.01 . 2 . . . . . . . . 5007 1 106 . 1 1 10 10 G C1' C 13 90.5 0.1 . 1 . . . . . . . . 5007 1 107 . 1 1 10 10 G C2' C 13 72.0 0.1 . 1 . . . . . . . . 5007 1 108 . 1 1 10 10 G C3' C 13 69.7 0.1 . 1 . . . . . . . . 5007 1 109 . 1 1 10 10 G C4' C 13 78.9 0.1 . 1 . . . . . . . . 5007 1 110 . 1 1 11 11 G H1 H 1 13.17 0.01 . 1 . . . . . . . . 5007 1 111 . 1 1 11 11 G H8 H 1 7.19 0.01 . 1 . . . . . . . . 5007 1 112 . 1 1 11 11 G C8 C 13 133.6 0.1 . 1 . . . . . . . . 5007 1 113 . 1 1 11 11 G N1 N 15 151.5 0.1 . 1 . . . . . . . . 5007 1 114 . 1 1 11 11 G H1' H 1 5.74 0.01 . 1 . . . . . . . . 5007 1 115 . 1 1 11 11 G H2' H 1 4.46 0.01 . 1 . . . . . . . . 5007 1 116 . 1 1 11 11 G H3' H 1 4.42 0.01 . 1 . . . . . . . . 5007 1 117 . 1 1 11 11 G C1' C 13 90.5 0.1 . 1 . . . . . . . . 5007 1 118 . 1 1 11 11 G C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 119 . 1 1 11 11 G C3' C 13 69.7 0.1 . 1 . . . . . . . . 5007 1 120 . 1 1 12 12 C H41 H 1 8.53 0.01 . 2 . . . . . . . . 5007 1 121 . 1 1 12 12 C H42 H 1 6.87 0.01 . 2 . . . . . . . . 5007 1 122 . 1 1 12 12 C H5 H 1 5.14 0.01 . 1 . . . . . . . . 5007 1 123 . 1 1 12 12 C H6 H 1 7.50 0.01 . 1 . . . . . . . . 5007 1 124 . 1 1 12 12 C C6 C 13 138.0 0.1 . 1 . . . . . . . . 5007 1 125 . 1 1 12 12 C H1' H 1 5.48 0.01 . 1 . . . . . . . . 5007 1 126 . 1 1 12 12 C H2' H 1 4.35 0.01 . 1 . . . . . . . . 5007 1 127 . 1 1 12 12 C C1' C 13 91.6 0.1 . 1 . . . . . . . . 5007 1 128 . 1 1 12 12 C C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 129 . 1 1 13 13 G H1 H 1 10.37 0.01 . 1 . . . . . . . . 5007 1 130 . 1 1 13 13 G H8 H 1 7.52 0.01 . 1 . . . . . . . . 5007 1 131 . 1 1 13 13 G C8 C 13 134.2 0.1 . 1 . . . . . . . . 5007 1 132 . 1 1 13 13 G N1 N 15 151.5 0.1 . 1 . . . . . . . . 5007 1 133 . 1 1 13 13 G H1' H 1 5.67 0.01 . 1 . . . . . . . . 5007 1 134 . 1 1 13 13 G H2' H 1 4.55 0.01 . 1 . . . . . . . . 5007 1 135 . 1 1 13 13 G H3' H 1 4.42 0.01 . 1 . . . . . . . . 5007 1 136 . 1 1 13 13 G C1' C 13 90.0 0.1 . 1 . . . . . . . . 5007 1 137 . 1 1 13 13 G C2' C 13 72.5 0.1 . 1 . . . . . . . . 5007 1 138 . 1 1 14 14 U H3 H 1 11.18 0.01 . 1 . . . . . . . . 5007 1 139 . 1 1 14 14 U H5 H 1 5.64 0.01 . 1 . . . . . . . . 5007 1 140 . 1 1 14 14 U H6 H 1 7.70 0.01 . 1 . . . . . . . . 5007 1 141 . 1 1 14 14 U C6 C 13 141.3 0.1 . 1 . . . . . . . . 5007 1 142 . 1 1 14 14 U N3 N 15 162.0 0.1 . 1 . . . . . . . . 5007 1 143 . 1 1 14 14 U H1' H 1 5.69 0.01 . 1 . . . . . . . . 5007 1 144 . 1 1 14 14 U H2' H 1 4.38 0.01 . 1 . . . . . . . . 5007 1 145 . 1 1 14 14 U C1' C 13 88.9 0.1 . 1 . . . . . . . . 5007 1 146 . 1 1 14 14 U C2' C 13 72.9 0.1 . 1 . . . . . . . . 5007 1 147 . 1 1 15 15 C H5 H 1 5.95 0.01 . 1 . . . . . . . . 5007 1 148 . 1 1 15 15 C H6 H 1 7.81 0.01 . 1 . . . . . . . . 5007 1 149 . 1 1 15 15 C C6 C 13 139.9 0.1 . 1 . . . . . . . . 5007 1 150 . 1 1 15 15 C H1' H 1 5.46 0.01 . 1 . . . . . . . . 5007 1 151 . 1 1 15 15 C H2' H 1 4.47 0.01 . 1 . . . . . . . . 5007 1 152 . 1 1 15 15 C H3' H 1 4.16 0.01 . 1 . . . . . . . . 5007 1 153 . 1 1 15 15 C C1' C 13 87.4 0.1 . 1 . . . . . . . . 5007 1 154 . 1 1 15 15 C C2' C 13 72.5 0.1 . 1 . . . . . . . . 5007 1 155 . 1 1 16 16 G H8 H 1 7.75 0.01 . 1 . . . . . . . . 5007 1 156 . 1 1 16 16 G C8 C 13 134.3 0.1 . 1 . . . . . . . . 5007 1 157 . 1 1 16 16 G N1 N 15 149.6 0.1 . 1 . . . . . . . . 5007 1 158 . 1 1 16 16 G H1' H 1 5.73 0.01 . 1 . . . . . . . . 5007 1 159 . 1 1 16 16 G H2' H 1 4.14 0.01 . 1 . . . . . . . . 5007 1 160 . 1 1 16 16 G C1' C 13 90.5 0.1 . 1 . . . . . . . . 5007 1 161 . 1 1 16 16 G C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 162 . 1 1 17 17 U H3 H 1 11.18 0.01 . 1 . . . . . . . . 5007 1 163 . 1 1 17 17 U H5 H 1 5.86 0.01 . 1 . . . . . . . . 5007 1 164 . 1 1 17 17 U H6 H 1 7.86 0.01 . 1 . . . . . . . . 5007 1 165 . 1 1 17 17 U C6 C 13 141.7 0.1 . 1 . . . . . . . . 5007 1 166 . 1 1 17 17 U N3 N 15 162.0 0.1 . 1 . . . . . . . . 5007 1 167 . 1 1 17 17 U H1' H 1 5.99 0.01 . 1 . . . . . . . . 5007 1 168 . 1 1 17 17 U H2' H 1 4.43 0.01 . 1 . . . . . . . . 5007 1 169 . 1 1 17 17 U H3' H 1 4.61 0.01 . 1 . . . . . . . . 5007 1 170 . 1 1 17 17 U H4' H 1 4.53 0.01 . 1 . . . . . . . . 5007 1 171 . 1 1 17 17 U H5' H 1 4.10 0.01 . 2 . . . . . . . . 5007 1 172 . 1 1 17 17 U H5'' H 1 4.22 0.01 . 2 . . . . . . . . 5007 1 173 . 1 1 17 17 U C1' C 13 88.0 0.1 . 1 . . . . . . . . 5007 1 174 . 1 1 17 17 U C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 175 . 1 1 17 17 U C3' C 13 74.3 0.1 . 1 . . . . . . . . 5007 1 176 . 1 1 17 17 U C4' C 13 82.7 0.1 . 1 . . . . . . . . 5007 1 177 . 1 1 17 17 U C5' C 13 65.0 0.1 . 1 . . . . . . . . 5007 1 178 . 1 1 18 18 C H5 H 1 5.91 0.01 . 1 . . . . . . . . 5007 1 179 . 1 1 18 18 C H6 H 1 7.66 0.01 . 1 . . . . . . . . 5007 1 180 . 1 1 18 18 C H1' H 1 5.71 0.01 . 1 . . . . . . . . 5007 1 181 . 1 1 18 18 C H2' H 1 4.13 0.01 . 1 . . . . . . . . 5007 1 182 . 1 1 18 18 C H3' H 1 4.41 0.01 . 1 . . . . . . . . 5007 1 183 . 1 1 18 18 C H4' H 1 3.92 0.01 . 2 . . . . . . . . 5007 1 184 . 1 1 18 18 C H5' H 1 3.85 0.01 . 2 . . . . . . . . 5007 1 185 . 1 1 18 18 C C1' C 13 88.9 0.1 . 1 . . . . . . . . 5007 1 186 . 1 1 18 18 C C2' C 13 73.5 0.1 . 1 . . . . . . . . 5007 1 187 . 1 1 18 18 C C3' C 13 75.0 0.1 . 1 . . . . . . . . 5007 1 188 . 1 1 18 18 C C4' C 13 81.9 0.1 . 1 . . . . . . . . 5007 1 189 . 1 1 18 18 C C5' C 13 64.3 0.1 . 1 . . . . . . . . 5007 1 190 . 1 1 19 19 G H1 H 1 13.01 0.01 . 1 . . . . . . . . 5007 1 191 . 1 1 19 19 G H8 H 1 7.71 0.01 . 1 . . . . . . . . 5007 1 192 . 1 1 19 19 G C8 C 13 137.4 0.1 . 1 . . . . . . . . 5007 1 193 . 1 1 19 19 G N1 N 15 152.0 0.1 . 1 . . . . . . . . 5007 1 194 . 1 1 19 19 G H1' H 1 5.61 0.01 . 1 . . . . . . . . 5007 1 195 . 1 1 19 19 G H2' H 1 4.62 0.01 . 1 . . . . . . . . 5007 1 196 . 1 1 19 19 G H3' H 1 4.43 0.01 . 1 . . . . . . . . 5007 1 197 . 1 1 19 19 G C1' C 13 88.9 0.1 . 1 . . . . . . . . 5007 1 198 . 1 1 19 19 G C2' C 13 74.7 0.1 . 1 . . . . . . . . 5007 1 199 . 1 1 19 19 G C3' C 13 81.0 0.1 . 1 . . . . . . . . 5007 1 200 . 1 1 20 20 C H41 H 1 8.70 0.01 . 2 . . . . . . . . 5007 1 201 . 1 1 20 20 C H42 H 1 6.91 0.01 . 2 . . . . . . . . 5007 1 202 . 1 1 20 20 C H5 H 1 5.46 0.01 . 1 . . . . . . . . 5007 1 203 . 1 1 20 20 C H6 H 1 7.64 0.01 . 1 . . . . . . . . 5007 1 204 . 1 1 20 20 C H1' H 1 5.73 0.01 . 1 . . . . . . . . 5007 1 205 . 1 1 20 20 C H2' H 1 3.99 0.01 . 1 . . . . . . . . 5007 1 206 . 1 1 20 20 C H3' H 1 4.17 0.01 . 1 . . . . . . . . 5007 1 207 . 1 1 20 20 C H4' H 1 4.42 0.01 . 1 . . . . . . . . 5007 1 208 . 1 1 20 20 C C1' C 13 90.5 0.1 . 1 . . . . . . . . 5007 1 209 . 1 1 20 20 C C2' C 13 72.4 0.1 . 1 . . . . . . . . 5007 1 210 . 1 1 21 21 C H41 H 1 8.49 0.01 . 2 . . . . . . . . 5007 1 211 . 1 1 21 21 C H42 H 1 5.53 0.01 . 2 . . . . . . . . 5007 1 212 . 1 1 21 21 C H5 H 1 5.46 0.01 . 1 . . . . . . . . 5007 1 213 . 1 1 21 21 C H6 H 1 7.73 0.01 . 1 . . . . . . . . 5007 1 214 . 1 1 21 21 C C6 C 13 138.8 0.1 . 1 . . . . . . . . 5007 1 215 . 1 1 21 21 C H1' H 1 5.49 0.01 . 1 . . . . . . . . 5007 1 216 . 1 1 21 21 C H2' H 1 4.38 0.01 . 1 . . . . . . . . 5007 1 217 . 1 1 21 21 C C1' C 13 95.6 0.1 . 1 . . . . . . . . 5007 1 218 . 1 1 22 22 C H41 H 1 8.20 0.01 . 2 . . . . . . . . 5007 1 219 . 1 1 22 22 C H42 H 1 6.91 0.01 . 2 . . . . . . . . 5007 1 220 . 1 1 22 22 C H5 H 1 5.38 0.01 . 1 . . . . . . . . 5007 1 221 . 1 1 22 22 C H6 H 1 7.60 0.01 . 1 . . . . . . . . 5007 1 222 . 1 1 22 22 C H1' H 1 5.34 0.01 . 1 . . . . . . . . 5007 1 223 . 1 1 22 22 C H2' H 1 4.52 0.01 . 1 . . . . . . . . 5007 1 224 . 1 1 22 22 C H3' H 1 4.36 0.01 . 1 . . . . . . . . 5007 1 225 . 1 1 22 22 C C1' C 13 91.6 0.1 . 1 . . . . . . . . 5007 1 226 . 1 1 22 22 C C2' C 13 72.4 0.1 . 1 . . . . . . . . 5007 1 227 . 1 1 23 23 C H5 H 1 5.62 0.01 . 1 . . . . . . . . 5007 1 228 . 1 1 23 23 C H6 H 1 7.63 0.01 . 1 . . . . . . . . 5007 1 229 . 1 1 23 23 C H1' H 1 5.45 0.01 . 1 . . . . . . . . 5007 1 230 . 1 1 23 23 C H2' H 1 3.90 0.01 . 1 . . . . . . . . 5007 1 231 . 1 1 23 23 C H3' H 1 4.34 0.01 . 1 . . . . . . . . 5007 1 232 . 1 1 23 23 C C1' C 13 92.5 0.1 . 1 . . . . . . . . 5007 1 233 . 1 1 23 23 C C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 234 . 1 1 24 24 G H1 H 1 10.01 0.01 . 1 . . . . . . . . 5007 1 235 . 1 1 24 24 G H8 H 1 8.12 0.01 . 1 . . . . . . . . 5007 1 236 . 1 1 24 24 G C8 C 13 136.6 0.1 . 1 . . . . . . . . 5007 1 237 . 1 1 24 24 G N1 N 15 148.8 0.1 . 1 . . . . . . . . 5007 1 238 . 1 1 24 24 G H1' H 1 5.49 0.01 . 1 . . . . . . . . 5007 1 239 . 1 1 24 24 G H2' H 1 4.35 0.01 . 1 . . . . . . . . 5007 1 240 . 1 1 24 24 G H3' H 1 4.36 0.01 . 1 . . . . . . . . 5007 1 241 . 1 1 24 24 G C1' C 13 86.9 0.1 . 1 . . . . . . . . 5007 1 242 . 1 1 24 24 G C2' C 13 72.9 0.1 . 1 . . . . . . . . 5007 1 243 . 1 1 24 24 G C3' C 13 70.2 0.1 . 1 . . . . . . . . 5007 1 244 . 1 1 25 25 A H2 H 1 7.97 0.01 . 1 . . . . . . . . 5007 1 245 . 1 1 25 25 A H8 H 1 7.51 0.01 . 1 . . . . . . . . 5007 1 246 . 1 1 25 25 A C8 C 13 137.3 0.1 . 1 . . . . . . . . 5007 1 247 . 1 1 25 25 A H1' H 1 5.50 0.01 . 1 . . . . . . . . 5007 1 248 . 1 1 25 25 A H2' H 1 4.76 0.01 . 1 . . . . . . . . 5007 1 249 . 1 1 25 25 A H3' H 1 4.36 0.01 . 1 . . . . . . . . 5007 1 250 . 1 1 25 25 A H4' H 1 4.27 0.01 . 1 . . . . . . . . 5007 1 251 . 1 1 25 25 A C1' C 13 90.5 0.1 . 1 . . . . . . . . 5007 1 252 . 1 1 25 25 A C2' C 13 72.9 0.1 . 1 . . . . . . . . 5007 1 253 . 1 1 25 25 A C3' C 13 70.2 0.1 . 1 . . . . . . . . 5007 1 254 . 1 1 25 25 A C4' C 13 79.6 0.1 . 1 . . . . . . . . 5007 1 255 . 1 1 26 26 G H1 H 1 13.17 0.01 . 1 . . . . . . . . 5007 1 256 . 1 1 26 26 G H8 H 1 7.41 0.01 . 1 . . . . . . . . 5007 1 257 . 1 1 26 26 G C8 C 13 133.3 0.1 . 1 . . . . . . . . 5007 1 258 . 1 1 26 26 G N1 N 15 152.0 0.1 . 1 . . . . . . . . 5007 1 259 . 1 1 26 26 G H1' H 1 4.13 0.01 . 1 . . . . . . . . 5007 1 260 . 1 1 26 26 G H2' H 1 4.18 0.01 . 1 . . . . . . . . 5007 1 261 . 1 1 26 26 G H3' H 1 4.26 0.01 . 1 . . . . . . . . 5007 1 262 . 1 1 26 26 G C1' C 13 89.7 0.1 . 1 . . . . . . . . 5007 1 263 . 1 1 26 26 G C2' C 13 72.2 0.1 . 1 . . . . . . . . 5007 1 264 . 1 1 26 26 G C3' C 13 70.0 0.1 . 1 . . . . . . . . 5007 1 265 . 1 1 27 27 C H41 H 1 8.54 0.01 . 2 . . . . . . . . 5007 1 266 . 1 1 27 27 C H42 H 1 5.23 0.01 . 2 . . . . . . . . 5007 1 267 . 1 1 27 27 C H5 H 1 5.17 0.01 . 1 . . . . . . . . 5007 1 268 . 1 1 27 27 C H6 H 1 7.39 0.01 . 1 . . . . . . . . 5007 1 269 . 1 1 27 27 C C6 C 13 138.5 0.01 . 1 . . . . . . . . 5007 1 270 . 1 1 27 27 C H1' H 1 5.48 0.01 . 1 . . . . . . . . 5007 1 271 . 1 1 27 27 C H2' H 1 4.34 0.01 . 1 . . . . . . . . 5007 1 272 . 1 1 27 27 C H3' H 1 4.25 0.01 . 1 . . . . . . . . 5007 1 273 . 1 1 27 27 C C1' C 13 91.1 0.1 . 1 . . . . . . . . 5007 1 274 . 1 1 27 27 C C2' C 13 73.2 0.1 . 1 . . . . . . . . 5007 1 275 . 1 1 28 28 G H1 H 1 11.08 0.01 . 1 . . . . . . . . 5007 1 276 . 1 1 28 28 G H22 H 1 6.30 0.01 . 2 . . . . . . . . 5007 1 277 . 1 1 28 28 G H8 H 1 7.55 0.01 . 1 . . . . . . . . 5007 1 278 . 1 1 28 28 G C8 C 13 134.9 0.1 . 1 . . . . . . . . 5007 1 279 . 1 1 28 28 G N1 N 15 148.3 0.1 . 1 . . . . . . . . 5007 1 280 . 1 1 28 28 G H1' H 1 5.70 0.01 . 1 . . . . . . . . 5007 1 281 . 1 1 28 28 G H2' H 1 4.66 0.01 . 1 . . . . . . . . 5007 1 282 . 1 1 28 28 G H3' H 1 4.26 0.01 . 1 . . . . . . . . 5007 1 283 . 1 1 28 28 G H4' H 1 4.44 0.01 . 1 . . . . . . . . 5007 1 284 . 1 1 28 28 G C1' C 13 91.3 0.1 . 1 . . . . . . . . 5007 1 285 . 1 1 28 28 G C2' C 13 72.2 0.1 . 1 . . . . . . . . 5007 1 286 . 1 1 28 28 G C3' C 13 70.3 0.1 . 1 . . . . . . . . 5007 1 287 . 1 1 29 29 C H41 H 1 8.47 0.01 . 2 . . . . . . . . 5007 1 288 . 1 1 29 29 C H42 H 1 7.09 0.01 . 2 . . . . . . . . 5007 1 289 . 1 1 29 29 C H5 H 1 5.27 0.01 . 1 . . . . . . . . 5007 1 290 . 1 1 29 29 C H6 H 1 7.65 0.01 . 1 . . . . . . . . 5007 1 291 . 1 1 29 29 C H1' H 1 5.47 0.01 . 1 . . . . . . . . 5007 1 292 . 1 1 29 29 C H2' H 1 4.45 0.01 . 1 . . . . . . . . 5007 1 293 . 1 1 29 29 C C1' C 13 91.3 0.1 . 1 . . . . . . . . 5007 1 294 . 1 1 30 30 C H5 H 1 5.25 0.01 . 1 . . . . . . . . 5007 1 295 . 1 1 30 30 C H6 H 1 7.72 0.01 . 1 . . . . . . . . 5007 1 296 . 1 1 30 30 C C6 C 13 140.4 0.1 . 1 . . . . . . . . 5007 1 297 . 1 1 30 30 C H1' H 1 5.52 0.01 . 1 . . . . . . . . 5007 1 298 . 1 1 30 30 C H2' H 1 4.41 0.01 . 1 . . . . . . . . 5007 1 299 . 1 1 30 30 C C1' C 13 91.3 0.1 . 1 . . . . . . . . 5007 1 300 . 1 1 30 30 C C2' C 13 72.7 0.1 . 1 . . . . . . . . 5007 1 stop_ save_